Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13914  (registered. 2012)
Contig Information
Length 1156 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_RDr Root of dessiccated seed 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 1
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57239851|gb|AAW49219.1|| protein kinase 1 [Aegilops tauschii]
Score 463
Evalue 2.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13914
ATCCGAGTGGTAGCTCAAGGAAAACTTTGGTAGTAGGCAACCGGCGACGTGCAACGACCTGAGGCGAATGAGACCGATGTGAAGTGTGTGTGTGTGTGTA
AATCCTACCAGTAGATGCACTAGATCAGAGGGGATGTTGAGCTCTAGCTGCTCTGTACAAGGCCCGCGGGCTCACTTAGCCATGCATTATTGCAGACATA
TTTTCCTCGTGCCGAATTCGGCACGAGGCCCTCACCTTCCTCCCCCCTCCCCCGCCAGGCCCCTCCCGCTCCCTCTCCTCGCTCGGGTGCTTCCTCCCTC
CCTCTGTCCACTCCACTCGCCACTGGCTCCGTTCGGTCCGTGAATCTTGACCGACCCGCCTGAGCCGGCAGCCACCGGTGGCCTGCTGCCGCCTCTCGCT
CCAGTGGTGGTGTGGCTACGAGCTGCGGACGGAGGGGGTCCGGGATGGAGCGGTACGAGGTGATCAAGGACATAGGCTCGGGCAACTTCGGGGTGGCCAA
GCTGGTCCGGGACGTCAGGACCAAGGAGCTCTTCGCCGTCAAGTTCATCGAGAGGGGGCACAAGATTGATGAGAATGTTCAAAGGGAGATTATGAACCAC
AGATCTCTGAGGCATCCGAATATTGTTAGATTCAAAGAGGTTGTGCTAACTCCCACACATTTGGCCATAGTTATGGAATACGCTGCTGGCGGTGAGCTAT
TCGAAAGGATCTGCAGTTCTGGAAGATTTAGCGAGAATGAGGCTAGGTTCTTCTTCCAACAATTGCTTTCAGGAGTTAGCTATTGCCATTCCATGCAAAT
ATGTCATAGAGATCTGAAACTAGAAAACACACTCCTGGATGGAAGCGAAGCACCCCGGCTCAAGATATGTGATTTCGGTTACTCCAAGTCCTCTGTGTTG
CATTCTCAACCAAAATCAACCGTCGGTACTCCTGCCTACATTGCCCCCGAGGTCCTTTCTAGAAGGGAATATGATGGAAAGGTCGCTGATGTCTGGTCGT
GTGGAGTAACCCTATATGTGATGCTTGTCGGCGCTTATCCTTTTGAGGACCCAGACGAACCAAANNNNNNCCGCAAGACAATTACTCGGATACTCAGCGT
ACAATATGCAGTACCCGATTACGNNNGGATTTCAATGGAGTGCAGGCATTTGCTGT
page-top