Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13902  (registered. 2012)
Contig Information
Length 1342 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219887441|gb|ACL54095.1|| unknown [Zea mays]
Score 610
Evalue 2.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13902
TTTTTTTTTTACAAATACAATACTCCTTAAAAGTGCAGTTCAACTGCTTTCCAGGCAGGTACAGAAGAGCTGAATAGGTACAATTTCCCAACTATGGATT
ATACAAATACCAGTTGTGCAGCTTATCCACAAGGGGACGTTGGCATGCATCTGGTAAATCGTTGGGCGATACTCCTGAGCTGATATCCCAGCGTAAACCA
CGAGGGTCCGCTGAAGTAAGCTTCGGATACGAAGTATCATGGCGTATATGTACAAAAAGAACATGTGTAAGACCTAATATTCATCGCATAAATGCCACCA
TACTCTTGCAGCAGATGTAGCGCTAATCGTGATGCAGAATCTGTTCACAGGATCCAGAGCTGTTCCATCAGAGTTCTGATGACATGCCAGTGGACATTGC
GGCTCTGCTAGTGAGCGCGGGCCTCATTGTCACCAGAGCAGATTCGTTTGCACCTGCCCTAAGGGCGATCCTTCCGGCTTCCAGGAATCGGGAGACGGCA
TCCTCTGCATAGCGGTTTGCTTCGCCTACACTCATCGTCTTGCCAATATCCGGATAGCTGTTGAGTACATGGTCACCGTTGAGCTGAGAGGCAAGTTGAA
TCAACTCCACTTGGAACTCCGATAGAGATTTATCTTCATTAGCACCGAACGGTCGCAGAGACTTTGTAACCTCTGGGAGTTTCTCTGGACAATCAGTTCT
TGGTGTCTTTCGAACTTTGAGGTAGCTCTCAAAGGTCCCAGCCCATGAATCCCTCTTTGTCAGGTAGTTAGCACGTAAATTAAATAGCTTCTTTACTGTC
GCAGGGATGGATGAATGCTCATATTGTGAGGTTTCCTCAGGACCATTTGGTTCATGGATCACGGTGCCCTTCTCAACCCAGGGCGAGATGAGGAAGCTGG
GCACGCGCACCCCGAGCCGATCAAACTTGAAGTAGTAAGGGTCAGGGCCAATGATCCCATCAGGCTGAGGCACTTTGACAGGCGTGGGAACATGGTCATA
GAAGCCACCATGCTCATCATAGGTGATGATGAGAGCCGTCTCGTTCCACTGCGGGCTCGCCCGCAGTGTCTCGTAGACCTCCTTGACAAACCTCTGGCCC
CTGGCGACGTCGTGCGACGGGTGGTCGTCGTTGGCCGGAAACTCCTTGCAATCGAAGTACCTCTGCTCGATGACGACGTAATTGGGCAGCTTGCCCCTGG
CGGCGTCGAGCTTGAACCTGAGGCTGTACTGGTGGAACTTGAGGAGGTGCTTGAGCCTGCGGAGGCTCTGGTAGAAGAGCGTGGCCGGGATGTTCTGGTA
GTAGATGCCGAAGGAGAGGCCGTCCTCCTCGAGGCTGTCGAA
page-top