Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13901  (registered. 2012)
Contig Information
Length 1511 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|121483256|gb|ABM54074.1|| GTP cyclohydrolase 1 isoform TaA [Triticum aestivum]
Score 773
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13901
AGTACATGAGAATGAGACAACCACTTAAAACATTTATACTGTATTGCTCGGCACAGCCGCCACACCTACAACGCTAGGATAACTTTGACATGTCGTTCAA
ACGAAAATGGTACAACACGGGAGAACCAAAACTTTCTGGTGCTTCTGGTTAATCTTCTTCAGACACAACATTCCACGCGACGAGGTCCTGGTCGCTCCCA
CCTGCAATGGCTGGTAAAATGGCAACCATGCCATAGCTGCATGACAACTTCAAACCATATATATAGTCGTCGCAGTGCCTGCCTTGCTGAAATGACGACC
AGGGATTAGACTCATTGTATCTTTTCGCTGAGATTCTATCAGTATATGATCTGAAGCCACTCATACTTCCTGATTAGCAGTATCTAAGACGTTCTGTAGA
AAGGATGCCTTGGCAGAAGAATCGGTTGAAAACTGACCCAAAACTGCAATTGTTGCTGTACTACTCCTGATTTTCTCTATTCCCCTTGATATCATGCAGA
TATGGTTTGCTTCTACAACAACTATGGCTCCACGATGTGAGACGGAATAAACTGCTTCAGCTATCTGTCTTGTCATCCTTTCCTGGACCTGAAGCTTGCA
CCCGTAGAAATGAACCAGAGCCTGAAAATGTGAGCGGTTGATCCCTTCACCGTCTCCACTGCCAAAGTAACCAATGTGCACTACTCCGTAGAACGGCAGG
AGGTGGTGCTCGCACTGGGCACAAAATGGCAAATGCAGCTCAGAACCAATTGCTCGATGATCAGTAGCATCTTCGCCTGGTCTCTCATATACACTTGCAC
TGTTAAGTGTAAAACCATTCAGCTTCACATCAAGATTGCATGCTCTGAACCTCATCAGCCATTGCACGTAACGCTGAGGACTGCCTAGAAGTTCTTTCCT
TAGGGGGTCCTCACCAAGAGACAGGAGCATTGAGCTGACAGCAGAAACCATATTAGATGGAATGGATGCCGATTTTGCTGAGCTAGCACCATTGGTTGTA
ATCTTCTTTGCATGCCCATTGCAAAGCGGAACCTCATGAGGCCTTAAGGGGCACCAAGTTAAAGAAGCAGAACGGCTGTCCATCTCCATGTCTATGCCTC
TAAGCTTAAGAAGAGCCACAAAATCATTCCAAAAGGAGCTGTTCTCGCCCTCAAAAACTCCCGAACGAGATGAATGTGAGGTTCTAATCAAAGCTCGCGA
ATTTTTGCATTTGAAGTTCTCCGGCAACGGTATGTGCCAGCACTGCATAGCAACAGCAACACCAGCAGGTTGTATGCTAACATGCAATGCACCACAAACT
TCATTAGCTAATCTCTGAGGGTTTTGAAATCTCTTGGCAAAGACATCAGCTACTCTTGAAAGCTTGCTTAACCCAACGACCCTTCCACCGGAGGGCACAT
ATCCAACATGGCATTGTATGCTGAACGGAAGTAAGCAAGACTCACAGTATGAATAAAGATCGATATCACGAACAACAACTTGCCCTCCAGTTCCTCCAGC
AGAACCAGTCC
page-top