Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13898  (registered. 2012)
Contig Information
Length 856 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 3
Wh_RDr Root of dessiccated seed 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 7
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|82780762|gb|ABB90550.1|| putative steroid membrane binding protein [Triticum aestivum]
Score 372
Evalue 3.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13898
GGGAGGATTTGCAAACGCATAAGAAAATGCAAGACACATTTTTTTTTTACTTTAGACAACAGCTAAATTATTCACCCAAAAGTATCAACCGACGGCTTAA
CAAAGGGGAGGCACACGCACACCCCGCTACCCCAGTAATATCCAGCACTCCATTTTACCGACTAACAATAACAGCGCACCAGCACTATATCCCCATGTCC
AACGTGCTGGTACAGATTACATACTGAATGACACAGATTTATTGCCACCACAAGGGGGTATGGGATTGCTCTAGCTCTCGGCGCTGACTGCGTCGGCTGT
GGCTTCCTTCTCTTTTACCTCCTCCGAGCTCACCTCCCTCGGCTTGTGCTCCGTGGCGGGTGCCTTCTCGGTCTCTGCCTCGGCGGTGACTGTTTCATTT
GTTTCTGGGGATGTGCTTGTGGTGCCGTCTTCTGCGGGAGCTGCCTTCTTGATGGTGCCGACCTTCACATATTTGCTCATGAACTTGTATTCCCAGTCTT
GCAGGGCGTCGAGCTCAAACGGCCCGAGGCCAGAGGTATCACCGTTCAGGTCCTGGGGCTCGAAAGACATCTTGGCTAGAGCTCTGCTGGCGTCTTTGCC
AGCGAATAGGGCATAAGGTCCACCAGGTCCGTAGAACATTCTGCTCTGCGTGACGTCATAGATCTGACCCTTGATGGCCATGAGGAGGGGTTTCTTGGGG
TCGGACCCGTCGTACTGCCGGAGCTCCTCCTCGTCGACCTCGCCCAGCTGCACGGGCGGCGGGAGCGGCTCCGCCTCGGGCTCCTCGAGCGGCCGCTGCC
GGGGNNNNGGCGGCGGCGCAAAGATCCCCGACACGACGTGGTACAGCGCGGCGGCG
page-top