Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13895  (registered. 2012)
Contig Information
Length 736 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464923|ref|NP_001056061.1|| Os05g0519200 [Oryza sativa (japonica cultivar-group)]
Score 356
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13895
AAAGGTGTCTCGTGTAGTTTGTGTTTATATACAACGAAAAATTGATTTACAGAGCTGTGATCTACTCCACATAACACGTTTTGGGAGGAAGAGGACACAC
GATCACAGCAGCTTCGGCGGCGGGGGCCCTGAGAAATCCGGTGGGCTATATGAGAGCTTTAGGATCCAGTTGGCAAGCCTGTTCTTGTTTTGCTCCTGAG
CTTCCTGGCAACTGGGGGTTGGGGTCTTCTCAATGGTTCCATATCTATCAAGAGTCGCCTTGAGATTTTCAAGGGTTTTAACTATCTGAGTAAACTCAGG
CCTCTTCTCGGGTTGAGCGGACCAGCATTGCTCCATCAATTGTTGCAATGGTGTCGGGCAGCTCGAAGGAACAACCGGTCTCAAGTTCTTATTAACAACT
GCATAAGCTGCTTGGAGAGGAGTCATCTCTTCATAAGGGATGGAACCACTAACCAGTTCCCACAAGACGAGCCCAAAACTATAGACATCGACTTTCGGAC
CATATGGCTTGCGCTTACACATCTCTGGCGCCATCCATCTATATGTGCCTGGGTCGTCTTCCATCGTGTTGCAGTAAACGTCTTCAAAAGCTACTCCGAA
ATCAACGACCTTTGCGCAACATTCTGCGTCGAATAGAATGTTCTCAGGCTTCACGTCACGGTGGATTACTCCTTGCGAATGCACGTATTCCAGACCACGT
GCAATGTCCAGGGCAACGGAGATAATCTTCTCCAAA
page-top