Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13859  (registered. 2012)
Contig Information
Length 1328 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199468|gb|EEC81895.1|| hypothetical protein OsI_25717 [Oryza sativa Indica Group]
Score 620
Evalue 2.00E-175
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13859
CCGCGGCTGACATCCCTCCCCAGCTTACACCTAGCCGCCGCCGCCGACGAAATCCACCCAAGCCGCCGAGCTCGTCTCGCCGTCGTCGCGCTCTAGGCTT
TTGGGATGGAGGCCGAGACGGCGGCGAAGAGGGCGCGGGAGAACGAGGGCGCTGCGGCGGCGGATGGAGCCGGGGAGCAGGCGGGGATCTCCGCCGTCAT
CCCCGGATGGTTCTCCGAGATCAGCCCCATGTGGCCCGGCGAGGCGCACTCGCTCAAGGTGGAGAAGGTCTTGTTCCAAGGCAAGTCGGACTACCAAGAC
GTGCTGGTTTTCCAGTCCTCCACCTACGGGAAGGTGCTCGTCCTGGATGGAGTGATCCAGGTGACCGAGAGGGACGAGTGCGCTTACCAGGAGATGATCA
CCCACCTTCCTCTCTGCTCAATCAAAGATCCCAAGAAGGTCCTGGTCATCGGGGGCGGAGACGGTGGCGTTCTGCGGGAGGTCTCACGGCACTCCTCGGT
GGAGCAGATCGACATCTGCGAGATCGACAAGATGGTGGTCGATGTGTCCAAGCAGTTCTTCCCTCATCTGGCCCTCGGGTTCGAGGACCCTCGCGTGTCC
CTGCACATCGGAGACGGCGTCGCCTTCCTGAAGAATGCTCCAGAGGGCACCTACGATGCGGTGATCGTCGATTCCTCCGATCCAGTAGGCCCTGCCCAGG
AGCTGTTCGAGAAGCCGTTCTTCCAGTCCGTCTCCAGGGCTCTGCGTCCGGGCGGGGTCGTCTGCACCCAGGCGGAGAGCATATGGCTGCACATGCACAT
CATAGAAGACATCGTCACCAACTGTCGCCAGGTTTTCAAAGGGTCCGTGAACTACGCATGGACTACGGTGCCCACATACCCTAGCGGAGTGATAGGTTTC
ATGCTCTGCTCCACGGAGGGGCCTAGTGTTGATTTCCAGCATCCCGTCTTCAGCATCGAGGAGGACGAATACTCCACAAAATCCAAGGGGCCGCTCAAGT
TCTACAACTCCGAGTTCCACACTGCATCGTTTTGTTTGCCATCATTTGCGAGGAGGGTCATTGAGGCCAAGGCTAACTAGATTCTTATGAAGATGGTCAC
TGAAACCAAGGCCAACTAGAATAACTTGTTTGGTTTCAATTTCAACACTGGGAGAAATCTGTCTTAGCGTAGACAGAGGAAAAGCCCCCTTTTTTATTAA
CTTGCAATAAGCCCACATGGAAATTATTGGTACCTGTGATTCTGTCTGCTGTATGTCTCAGGTTGTATTTCCTGGCTACCTCGTGGTATGAGAACCTTCT
GAATTTAGTTTTTTGCCCAAAAAAAAAA
page-top