Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13850  (registered. 2012)
Contig Information
Length 1249 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 3
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293335715|ref|NP_001170730.1|| hypothetical protein LOC100384817 [Zea mays]
Score 247
Evalue 2.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13850
TTTTTTTTTTGCGACAAGGTAACAAGAAACTTATTGCACAAAAAAAGTTGAGTTCACCGGTACCGGACAACAAAGACCAAAACAAATTGTTCAAATCATA
TAGTGATATATGGAAGTAAAACTTCCTCGCAGAAGGATGATTATAACGTGCTGTTGCCGACAGCAAACGCAAACGATGCAACATAAGTAGATGCAGTATA
CTTCGAGGGCCAACTTGCCAGCAAGCTAACTGTTCCTCGAACTTAATTCATAGTAGCCATAGATGAGCACGAGCAACACTAAACGGCATTTAGTCTCCAC
CACAGCAGCCACACACTGGCCATTCTCTGTAAGGTAGACAGTTTATCCAATGAGAGCTGAAGCACATAGCGCGCCTACAGTGACTGGATTCGAGTTCCTT
CGATCAAACCCCTCATGCCTGAGCATCCAAGCGTTCTGCGTACAATTCATCTCCATCAGACAGTCCCCAGATCAAAATCACCCTCCAACCTCCAACTGGC
CCCGGAAGACCTGGCACACCCAAACCTAACAGCAGCACTTGCTATGCTTCCAAGACCACCATTCTCCAAAAGAAATTTAACACTATGAAAGGGCTGCAGG
TATGGGTCCGAATTGAATAGGTATATCAAGCTGTGCCACTTACTCCAACAGATCCTCAGCGACTCCAGTAGTAACCATCCAGGTACAAGCTACTCCGTCA
CACAAGATAACGGCCAGATCCGATAGGTTTTGCCGGCTGCTTTTCAGCCACTTGACCACTATGCTGATTAATTTGTTGGTGGTTTTGAACCATATTCTGC
TTTGCAGGGTCAAAAAGGTGGAAATCTTGCCATGTTTTCTCACTGGCCCCTAAGGTGTACACCCCAGAAACCTGCTGTTTCCCAGGGAAAGGGAAGGGAG
TGGTGAATGCACTGCTGGTAGTGGCAACATCAGGATAAATAGCTTTTGAGTTATGAACACGTTCCAGTGATGGCTGGTAGCCATCCAGCCAGCTGTAATC
ATCGATCTGTTGGTGCTGCAGCTTCTCAAATGGCATAATATCATCATGGCGTTTTGGAGTGATGTGATTAAATCCTGGAGGAGGACCAACGGGCCTTGAT
GGACGACTCACAGGATTCTTCTTTGATACAGCTACAGGTGCGTCAGTGAGATTGATTGTCATCCCACCAGATGCTGCTACTGATGGTACAATTGAATCAG
AAGTGGATGGGATGGTTTCTTCAGTCGCTTTCACCTGATTATGCATCAA
page-top