Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13848  (registered. 2012)
Contig Information
Length 932 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VHS Shoot with heat shock treatment 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 518
Evalue 5.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13848
AGGGACAGCTCCCGTCTTAGCAGCCCAATGGCAGCGGCCACCATGTCCCTCTCCTCCCCGGCCTTCGCCGGCAAGGCGGTGAAGAATGTGTCGTTGTCGG
CCCTCTTCGGTGAGGCACGCGTCACCATGCGCAAGACTGCGGCAAAGGCAAAGCAAGTTGCTTCGAGCAGCCCGTGGTATGGTGCCGAACGCGTGCTCTA
CCTTGGCCCACTATCAGGTGAGCCGCCGAGCTATTTGACCGGTGAGTTCCCCGGTGACTACGGGTGGGACACCGCTGGACTATCGGCTGACCCCGAGACC
TTCGCAAAGAACCGTGAGCTGGAGGTGATCCATTGCCGATGGGCCATGCTTGGTGCCCTTGGCTGTGTCTTCCCTGAGTTGCTCGCCCGCAATGGTGTTA
AGTTTGGCGAGGCTGTTTGGTTCAAGGCTGGCTCCCAAATCTTCAGCGAGGGTGGCCTCGACTATCTCGGCAACCCCAGCCTCGTCCACGCGCAAAGCAT
CCTGGCCATTTGGGCTTGCCAAGTTGTGCTCATGGGTGCCGTCGAGGGGTTTCGCATTGCCGGTGGCCCACTTGGCGAGATCGTTGACCCACTTTACCCT
GGAGGCAGCTTTGACCCGCTCGGCCTAGCCGACGACCCTGAGGCGTTCGCGGAGCTCAAGGTGAAGGAGATCAAGAACGGCCGCCTTGCCATGTTCTCCA
TGTTTGGCTTCTTTGTGCAGGCCATCGTCACCGGCAAAGGCCCACTAGAGAACCTTGCTGACCATATCACTGATCCCGTCAACAACAATGCATGGGCATT
TGCCACCAACTTCGTGCCCGGCAAGTAAGACACCTACTAGGGCTGAGTTGAGAGCTGGCGGGGTGGTCTGATATGTACTACCATCATGTAAATTACAAGA
ATCCGTGCAAAAGCATTGTTTGAAAAAAAAAA
page-top