Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13805  (registered. 2012)
Contig Information
Length 566 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig13805
AAGCATAGAAAATTGTACATAGCAATGCAGAAATGGTTTATCCAGCTAGAGAACAACAAACTAGACATTTATTCCTTTATGGAACTCCTTACAACATGTG
CCACAATATTTAGAATCTATTTGACATATCGTGCATAAACATGAGACTACAAAATGCTCTTATAGGTACCTTGCTCGTATATGCGAGCATAAGGAGCAAA
TTTTATTCAAGCACATCAAGCATGTTTTTGTGGGACTGAACATGTTTTATTTAAAACACATATATATGTCTAGTTGTTTCTTGGTGACATCCACCATTTT
GACCCCTTTCACCATATCCACCCACCTCAAGGATAGCCACCACCACCACCGGAGCCTCCACCGTAACCTCCACCCCCGCCAGACCCGCCACCAGAGCCAT
ACCCTCCACCAGAGCCACTGCCATACCCACCATTGTTGCCACCACCGTAGCCAGGATTGCCGTACCCACCACCACGTCCTGGGTCACTGCCACCATTACC
ATATCCACCGTTGTTGCCGCCACCATAGCCAGGATTGCCATAACCACCGCCATATCCAGGATTTCC
page-top