Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13748  (registered. 2012)
Contig Information
Length 741 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_VHS Shoot with heat shock treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|126723796|gb|ABO26812.1|| caffeoyl-CoA O-methyltransferase [Bambusa oldhamii]
Score 371
Evalue 4.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13748
TTTTTTTTTTGGAGTACCAATATTAATCGTTTGTCTGGAGAAATCTTTATACGAATTGCAGAAGATAGATATAGAGTACAGAAGGCGAGCAGGAAAGACA
AAATGGGGAGTAATTAATTAATTCTTGTTCTTGGCGTCTATGGCGGAGCGGCGGAGACGGGTTCTGTGGTTCACTTGGCGCGGCGGCAGAGGGTGATGCC
GTCGCCGACGGGGAGCTGGCAGATCTCGACGCGCTGGTCGGCGGCGAGGGCCTTGTTGAGGTCGAGGACGAAGTCGCGGTAGTAGCGGATGTACTTGCGC
ATGGGGGCGTCGGCGGGGAGCACGACGGAGCCGTTCCAGAGCGTGTTGTCGTAGCCGAGGAGGCCGCCGAGCTTGACGAGCTTCATGAGGCGCTCGTGGT
AGTTGAGGTAGTTGTCCTTGTCGGCGTCCACGAAGACGAAGTCGAAGGTGCCGTGGTTGGCCTCGTCCTCCAGCAGCGCGTCCAGCACCGGCAGCGCCGG
GCCCTCGCGGAAGTCGATCTTGTGCGCCACGCCGGCCTTCTCGATGCACGGCAGCCCCAGCTCGTAGTTCTCGCGGTTGATGTCCATGGCCAAGATGGTG
CCGTCGTCGGGGATGGCGAGCGCGGTGGCGAGGAGGGAGTAGCCGGTGTAGACGCCGATCTCCATGGTCTTCTTGGCGCCGATGAGCTTGAGCAGCATGT
TGAGGAACTGGCCCTCGTCCGCCGACGTCGTCATCAGGTTC
page-top