Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13684  (registered. 2012)
Contig Information
Length 1058 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31753114|gb|AAH53854.1|| Unknown (protein for IMAGE:5194336) [Homo sapiens]
Score 150
Evalue 2.00E-34
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13684
ACCGCACAACGGCATACTTCACCGCAAGCGTGTGCACACACACATACACACCTTACTTGCCGGGAACAAAGTTGGTGGCGAATGCCCATGCGTTGTTGTT
GACGGGGTCGGAGAGGTGGTCAGCGAGGTTCTCTAGTGGACCCTTGCCGGTGACGATGGCTTGCACAAAGAAACCGAACATGGAAAACATAGCGAGGCGA
CCGTTCTTGATCTCCTTAACCTTGAGCTCGGTGAATGCCTCAGGGTCGTCGGCAAGGCCGAGCGGATCAAAGCCTCGTGCCGAATTCGGCACGAGGGGAT
ACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCATAGATCCGGAGATTCCCAAATAGGTCAACCT
TTTAAACTGCCTGCTGAATCCATGAGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAG
TAGCGGCGAGCGAAATGGGAGCAGCCTAAACCGTGAAAACGGGGTTGTGGGAGAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGCAC
CCTAGATGGCTAAAGTCCAGTAGCCGAAAGCATCACTAGCTTACGCTCTGACCCGAGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCA
CCTTGCAAGGCTAAATACTCCTGGGTGACCGATAGCGAAGTAGTACCGTGAGGGAAAGGTGAAAAGAACCCCCAGTGGGTAGTGAAATAGAACGTGAAAC
CGTGCTGAGCTCCCAAGCAGTGGGAGGGGAAAGTGATCTCTGACCGCGTGCCTGTTGAATGATTGAGCCGGCGTTTCTGCGAGGAAGAAGAGAGTGTTGG
AGAGAGTGAGGAGAGGGACCATGATTCTGAAGTCTGAACTTTGATGTAGTAACTCGTCTGTGTTTCTCTTGGTACTGGGACCTGTACTGTGCTACTCTGT
GACCTGCATTGTCTCCATTTTTCTGCGATCTAATCAATGGGCTCACCTAAAAAAAAAA
page-top