Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13658  (registered. 2012)
Contig Information
Length 626 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|147945622|gb|ABQ52657.1|| chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 262
Evalue 2.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13658
GCGGCCGTCACCGTGCAGCTCCCCGGAGGCGAGCGAGTGCNNNNNCTCTTCACCGTCAAGCAGCTCGTCGCTACCGGCAAGCCCGAGAGCTTCAGCGGGC
NNNTCCTCGTGCCCAGCTACAGGGGTTCGTCTTTCCTCGACCCAAAGGGCCGTGGTGGCTCTACTGGCTACGACAACGCCGTGGCGCTACCCGCCGGAGG
CAGAGGAGACGAGGAGGAGTTGGCTAAGGAGAACGTGAAGAACGCGTCCTCGTCCACGGGCAACATCACGCTCAGCGTGACCAAGAGCAAGCCGGAGACC
GGCGAGGTGATCGGTGTCTTCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGCCAAGGCGCCCAAGGATGTCAAGATCCAGGGTGTGTGGTACGCGC
AGCTCGAGTCTAACTAGAGCAGAGCAGAAGTGAAGATACTCATCTTGTGTGCATGCGTACGTGGGTTGATCGGTGGAGAGGAAACAATCGAGGCAACAAA
TGTGTTTGTGTGTGTATCTAGTAATCTAAACCCAGGGTGTCGGTTTATATTTTAGCTTCTGTTATTATTGTTTCTTCCTGGACAACTCATGATATTGATC
CCCCATGAATGTTCACAAAAAAAAAA
page-top