Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13639  (registered. 2012)
Contig Information
Length 1859 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XE Seedling, infected with leaf rust 9
WH_XF Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 34
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|13516744|dbj|BAB40322.1|| cytochrome P450 [Triticum aestivum]
Score 702
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13639
TTTTTTTTTTGCATAAAACACATATATTTCTGATCCACAAATCATATTCTCTAAGTAAATCCATTACATAGGTAAATCACACGGTAGTTAATAATAGTAG
ATGCATTATTCAAAAGTTCATAAGAACATACAGAACTAATACAGTCATGTTCTACATGATCATGTAACGTAAGATCTTCTCTTATTATTGATACGAGGAC
ATGATGTTTGCAATGAGCTTCTCTTATTGTATTGCATAAAGGTACAACCATACACTTCAATAATGACATCATTGACATGTCCTGAAAATGTAGGTATGTT
AACTTGCATAGCCACATGAATATGCAAGCTTTCTCTGTCACTTTGACCGCATAGCTTTGAACCACAAGTGTGGAGTAGCTTCAAGTTTCAGATCATACTT
TTTGCTTACTGCAAGCCCAAATTTCTCGGACATGTCAAGCGAAATCGGGCTAGCACCACCAGGAAGCTTCCAGTTGAAGTGATACAGAATATTTGTCAAT
GTCATCTCCAAGACCGACGAGCTAAACTGAATCGCAGGGCATTGTCGTCGCCCAGCACCAAAGGGAGTGAATTCAAAGTATGTGCCGTTGTAATTTGTGT
TGTTGTTCTCAAACCTCTCCGGCCTAAACTCTTCAGGATTGTTCCAGTATGCAGGATCTCGAGAAATTGCGAAGACGTTAATGTTTACATTGGTGCCTTT
GGGGATGTCATAACCCATGATAGTACAATCCTCTATGGACGCGCGAAGAACTAGAGAAGCAGGCGGATGGAACCTAAGGGTTTCCTTGATGATCATCTGC
ATGTAGTCGGGTTTAGCGAGGTCGCTATTAGTAATGACAGCTCGGTCTTGGCCAAGAACCTCTCGGACTTCTTGTTGTGCCTTGGCCATAGTTTCAGGAC
TGCGCACAAGCTCTGACATAGCCCACGTCAAGGTAGTTCCTATGGTCGACGTGGCACCTGCAAATATGTCAAACAAGACGGCGCCTATTATCTCGGTGGT
TAGAGGGAATTCCAACGAGTCCTCCTGCTGCAGCCTAAGCAACACATCCAGCAGGTCCTCCTCATCAGTGCTGGAGGCACCAACGCCGGCGGCCTTGCGC
CCCTCTATGACGTTGGCGATGATGCGTTGGATGTGGCCGTGGCACCTCCTCATGCGGCGCTCGTCGTTGCTGAGCCACCGGACTAGCCGCCACGACGGGA
AAAGGTCGACGGGGGAGAAGCCGCTCACCAGCGCAAACGCCTCATCCAGCTCGCGGAGGTACTCTTCCTGCTGCGTGAACTTGCCTCCGAAGACCGCCCT
CGTCACGATGTCGTTGCTCAGCTCCATCATCTTCTCGCTGACGTTAACGGTGGCGCCATCCAAGGCGGCGATGGAGCGGAGGAGGTTACCCACCTCCTCG
GCCCTGATGCTCTCTATGCGCTTCACCTGCCTGGAGCTGAGGAGCTCCACGATGCACACCTTGCGCATCTGGCGCCAATGGTCGCCGTAGGGGGCGAAGC
CGATGTTCTTGCCGCTGCAGCCGAAGATGTCGGACGTCACGCTCTGCGGCCGGTCCGCGAAGGCGGGGTCGTTGGTCCTCATCACCAGCGCCGCCGCCTC
GGCGCTCGAGACGATCACGGTTGGGACCTCGCCTAGCATGAGGTGCATCAGTGGGCCGTGTCGGCGAGACATGTCCATCATCCTGCGGTGAGGGAGGGCG
CTGGCGACATGGTGGAGGCTGCCGATGATCGGTAGAGTCCATGGCCCTGGCGGCAGCTGGTGGTGCTTCTGTGGCTTGTACTTGCTGCCGGCGAGCTTGA
GAAGCCAAAGGGCAAGCGGCGTGCATAGTGCTATGAAACACAAGCCGAACCACCCCTCC
page-top