Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1363  (registered. 2012)
Contig Information
Length 1984 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162462751|ref|NP_001105340.1|| ATP synthase subunit beta, mitochondrial precursor [Zea mays]"
Score 1006
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1363
ATTTCAGTTTCTTTTTTCACCGAGAACAAGCACACGGTGTGGCCGCTCATGTGTCACAAAAAGAGAACACTCTCTTCCTTGAAGGGCAGTAAGCCAGATA
AATAGGTCACTGCAAATCCTTATTCGGGAAAAAGTGGAGGGGGGGAACATCCATCAGCAGGGCCGGGCATCCTGCCTCTAAATACATATCCTGGCTAACA
GACAGTAAAAAGCACAACAGGTTGACCACGAAAAGGTTAAAATTGCAGGTTGCTTGTAAAGAGGAAGTTTCTTATCAAGCGTTCTCCTTGGCAATCTTCT
CTGCCTTGGCAATGACCTCCTCTATTCCTCCAACCATGTAGAATGCCTGCTCTGAAAGGTCATCGTATTTCCCATCCAGAACACCCTGGAAACTTTGAAC
ACCCTCCTTAAGCTCAACATACTTTCCAGGTGCTCCTGTGAAAACTTCAGCAACATGGAAAGGTTGGCTAAGGAACCGCTGAATTTTCCTAGCGCGGGCG
ACTGTTAACTTGTCGTCCTCACTGAGCTCATCCATTCCCAAAATGGCAATAATATCTTGAAGATTCTTGTAATTCTGAAGAACCTTCTGAACACCACGAG
CAGTGTTGTAGTGAGCCTCGCCAAGAACATGAGGAGACAACATTCTGGATGTGGAGTCCAAAGGATCGACAGCAGGATAAATACCGAGCTCGGAAATCTG
TCGTGACAGCACGGTGGTAGCATCAAGATGGGCAAAAGTGGTAGCAGGGGCCGGATCTGTCAAGTCATCAGCAGGCACATAAATAGCTTGCACGGATGTA
ATAGAACCCTTCTTTGTGGTGGTAATCCGCTCCTGCAGCCCTCCCAGGTCGGTAGCAAGGGTTGGTTGGTATCCCACAGCAGATGGAATACGTCCAAGCA
GAGCAGACACCTCAGAGTTTGCCTGAGTGAAACGGAAAATGTTATCAATGAAGAGAAGCACATCCTGTCCTTCGGCATCACGGAAATGCTCAGCGACAGT
CAAACCAGTCAGTCCAACACGAGCACGAGCACCAGGGGGCTCATTCATTTGCCCGTACACAAGAGCACACTTGCTCTCACTCTGCTTGTCGTCAAGCTTA
ATGACACCACTCTCAATCATTTCCCTGTACAAGTCATTACCCTCACGCGTACGTTCTCCAACACCAGCAAAGACAGAGAAACCACCATGGGCCTTGGCAA
CGTTGTTAATCAACTCCATAATAAGGACAGTTTTGCCCACCCCTGCACCACCGAAGAGACCAATTTTACCACCTCTTTGATAGGGTGCAAGTAGATCCAC
AACCTTAATTCCAGTAACAAGGATTTGTTGCTCGGTAGCTTGCTCAACGAAAGCAGGGGCTTCACGATGGATAGGCAGGTAACTGTTTGTTTTTATATCT
CCCTTGTGATCAATTGGCTCACCAATAACATTGATAATACGCCCAAGAGTCGCCCTACCAACAGGAACAGTGATCGGGGAGCCGGTGTTGAGGACGCGCT
GGCCGCGGACGAGCCCTTCCGTCCCGTCCATGGCGATGGTGCGGACGACGTTCTCCCCGAGATGCTGCGCCACCTCGAGCACAAGGCGGATGCTGTTGTC
GAGCACCTCCAGCGCCGTCAGGATCGGGGGGAGACCCTCGTCAAACCGCACGTCCACCACGGCACCAATGACCTGGCACACCTCACCCACCGCACCGGCG
CCGGTGAAGTCATCGGTAATCTTAGTGCCTGTGTGCTTGTCGGAGGTGGGGGGCGGCGTGACCGGAGCGGCCTGCGCCGCGGCGGATGACGAGTAGGAGG
CGGCGGCGCGGTTGAGCAGGAAGCCGGCCGGGGACGGGCGGTGGAGCGGCGCGCGGGGGCACGGGGAAGGGGAGGCGGCGCGGATGCGGGAGGCGGTGCG
GAGGACCGACGAGATGGCCCGGCGGGTGGCCATGGCCGGCGACGAGGGCTTGGATCTAGGTTTGCGAAATGGTCCGCGGGGTGG
page-top