Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13577  (registered. 2012)
Contig Information
Length 1231 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_CSEC Callus 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655466|emb|CAJ01707.1|| putative S-adenosylhomocystein hydrolase 2 [Hordeum vulgare subsp.
Score 658
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13577
TTTTTTTTTTCAGAAGGACAAAATTTTTTTCCTCATTTAAACCAAAATAATAACACTATTATTTCTGGGCAATAGCAATCCACCACACCCTCACCAGTCT
CAAACCATGACAAATCCTCCACCTAATAGACAACATGCCTAAATCTAGATAGATAATGCAAAGGAAAACAGGATAGTTCATAGGTCGCCGTGCGCCTCTC
AGGCTCAGGCCAGCCGCTAGTCGTGCTGGACAGACACACTAGTACCGGTATGCCGCCGGCTTGTAGGGACCATCGACTGGGATGCTAATGTACTCAGACT
GGGCCTTGGTGAGCTTGGTAAGCCTGGCACCCAGCTTGCCCAGGTGGAGGGCGGCGACCTTCTCGTCGAGGTGCTTGGGGAGCACGTACACCTTCTTCTC
GTACTTGCCGGTGGCCTTCTCCTTCCACAACTCCAGCTGAGCAATGACCTGGTTGGTGAATGAGCAGGACATGACAAAGCTGGGGTGGCCAGTGGCACAG
CCAAGGTTCATCAGACGACCCTCAGCAAGAACAATGATGCCAGTGTTGGTCTCAGGGAAGACCCAGCGGTCAGTCTGAGGCTTGATGGTGATGCGCTTGA
CACCAGGGTAGGTCTCGAGGCCGTTCATGTCGATCTCGTTGTCAAAGTGACCAATGTTGCAGACAATGGCGTTGTTCTTCATCTTCCTCATGTGGTCAAC
CATGATGATGTCCTTGTTTCCAGTGGTGGTCACAAAGATGTCAGCATCAGAGACAACGTCCTCCAAAGTGAGGATCTGGATGCCCTCCATCAGGGCCTGA
AGGGCGCAGATGGGGTCAATCTCTGTCACGATCACACGGGCACCAGCCTGCTTGAGTGCAGCGGCACAGCCCTTGCCAACATCACCATAACCGCAGACCA
CAGCAACCTTGCCAGCGATCATAACATCAGTGGCCCTCATAAGACCATCAGGGAGCGAGTGGCGGCAACCGTAAAGGTTGTCAAACTTGCTCTTGGTGAC
GGAGTCGTTGACGTTGATGGCGGGGAAGAGGAGGGTGCCGGACTCCTGCATCTGGTAGAGCCTCTTGACGCCGGTGGTGGTCTCCTCGGAGACGCCGACG
AGCCTCTCCTTCATCTTGCGGTACTTGCGGGCGTCGGTCTTGAGCCCGTCGCGGATGATGGTGAGCACGATCTTGAACTCGGGGTTGTCGGTGGAGTCCG
GGTCGGGGACCTTGCCGGACCTCTCGAACTC
page-top