Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13511  (registered. 2012)
Contig Information
Length 1024 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195626826|gb|ACG35243.1|| proteasome subunit beta type 7-A precursor [Zea mays]
Score 486
Evalue 2.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13511
GAAACTCGAAGCACAGGAACACGAAGCAAGCTGCTCCCCCTCCTCATCTCCGACTCACTCACGATCCGAGATCAGGATGGCCGGATCGATGGAACTCCCT
ACCAAGGGCGGCTTCAGCTTCGACCTGTGCCGCAGGAACGCCATGCTGGAGAAGAATGGCCTCAAGATGCCCGGGTTCAGGAAGACCGGAACTACCATCG
TCGGCCTCGTGTTTGCGGATGGAGTTGTTCTTGGGGCAGACACAAGGGCAACCGAGGGTCCTATAGTTGCTGATAAGAACTGCGAGAAAATTCATTTTAT
GGCACCAAACATATATTGCTGTGGTGCTGGAACTGCTGCTGACACAGAGGCTGTGACAGATATGGTCAGCTCCCAGCTACAACTTCACCGTTATGCTACT
AGCCGTGAGTCAAGAGTTGTAACCGCTCTTACACTACTGAAGACACATCTTTTTAACTACCAAGGTCATGTCAGTGCTGCTCTTGTTCTTGGCGGAGTGG
ATGTCACTGGACCACATCTGCACACTGTTTATCCGCATGGCTCCACCGATACTCTTCCTTTTGCCACGATGGGTTCTGGATCCCTTGCTGCAATGTCAGT
GTTTGAGTCGAAGTACAGAGAAGGCCTCACAAGGGAGGAAGGAATTGCACTTGTAGCCGAGGCAATCCGTGCTGGTATCTTCAATGACTTGGGAAGTGGC
AGCAATGTGGATGTTTGTGTGATAACTAAGGGGAACACAGAGTACTTGAGAAACCACGAGTTACCAAACCCAAGGACTTTTGTCAGCTCGAAGGGATACA
GCTTCAACAAGGGGCATACCGAGGTGTTGTCTACAAACATCACGCAGCTGAAGCTGAAGCCAGAGGTCGCTGATAGTGATGCAATGAGTGATCTTGTGTG
CTTACGTTCAGGCAAGCAGTCATGCTAAGAATTTGCGCCATTTCTTCTTTTTTCTCATCGTGGGTGCTAGAACGGAAAAATGGATGTATTTTGTTGTACT
TGCTGGATTTAATGCAGACCTTTA
page-top