Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13506  (registered. 2012)
Contig Information
Length 1196 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 4
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|164472646|gb|ABY59005.1|| calcium-dependent protein kinase [Triticum aestivum]
Score 560
Evalue 2.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13506
TTTTTTTTTTAGAGAGAAAAGGAAGTAACATCACATCCAGGACTGTTCATCAAACTGGACATGCTTCATTGGGACAAGCCATTTTAAGAGTTAACAATTC
CAGGGAGATATAGTAGGAGGTAATTCACTGAACATTTTGCAGGGATTAAGCAGCAGCAACGTGTGAGATCATTTCAACCCAGCTTAGCATGCGTTCCGTC
GAATCAATTGACGAGCTAAATCAGAATCCCCAGAAACACACATCCACACAGGCATTTTACAAGATTCGAAAATCGCAGGAAGTCTTGGTAGAGCAGGAAG
ACAGGAAGAAGCTAAAGCCACAAGCTGTATGTACATCGTGGAAGTCTAGATTGCACCAGGTGCGTCTCTCATGCTGATATTCAGGCTGTTTCTCATTGTT
CTTCGCCCCACCCCCATATTGCCCTTGGTCATCATGGCAACAAATTCTCCATAGTCGATGCGCCCATCATTGTCCTGGTCAGCTTCTTTAATGACATCAT
CAAGAAAAGCATCTGGCATGTTATGCTCTTGGCAAGCTTGCTGCAGTTCATCCACTGTGATGTAACCACTTCCATCTTTGTCGAAATATGAAAAGGCTGC
CACTAGATGTTCCTCACGCTCCAGTTTATTCAGATGCAATGTTGCAGCGATGAACTCTATATAGTCAATGGTCCCACTGTTGTCCACATCCGCCGCGTCC
ATAAGATCACGAATCTCGGTATCCTTCAATGTGGAGCCATATTTTCTCAAGCCTTCTTTGAGCTCATCATATGTAATTGCACCACTGTTATCGGCGTCCA
TAGTCTGGAACATTTCCTTCAACCCTGCAATTTCCTCCTCTGAGAGGCTCTCAGCTATTACCCGCAAAGCCATCTTCTTCAACTTATTCATCGCAGAGAA
TTGCTTAATGCGAGATAAGACAGCTGTGTCAAGAGGACGATCAGGAGCAACTCCCTGATCACGAATCCATGGATGGCATAGAACTTCGTGTGCTGTCAAG
CGTTCAGCTGGGCGAGGATTGAGCATTCTTGTTATCAGATCTTTTGCACTGTCAGATATCACAGGCCAGGGTTCAGAATCAAAATCGATTACACCTTTCA
GTACAGCATCAAATATTCCTTGCTGTGTCTCTGCCCAAAATGGGGGTACACCACTTAGCAGAATGTAGAGAATTACACCAGCGGTCCATACATCAG
page-top