Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig135  (registered. 2012)
Contig Information
Length 519 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 3
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440899|ref|NP_001044729.1|| Os01g0835900 [Oryza sativa (japonica cultivar-group)]
Score 210
Evalue 6.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig135
GCACGAGGGACCTCCTCCATCCGCCCGCAGCTCGAGCCAAGAAGAGATCGTCAGCCATGTCTGGCCGCGGCAAGGGAGGCAAGGGGCTCGGCAAGGGCGG
CGCTAAGCGCCACAGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCCGCCATCCGCCGCCTGGCTCGGAGGGGCGGCGTGAAGCGCATCTCG
GGGCTCATCTACGAGGAGACCCGTGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCG
TCACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGCTCTTCCTCGCCCCCCCTGCAGATCCCAAAA
GTTGGATGACACCGCGACTTGTGTAGTTCTCTGTTTGCTCTGTAGTTCGAACTGTATCGTGGAACAAAGTGGTTCGCATGTGTTGCTGGAAATCAAACCT
GTCCCAGTGAAAAAAAAAA
page-top