Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13484  (registered. 2012)
Contig Information
Length 1552 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108708600|gb|ABF96395.1|| Serine carboxypeptidase family protein, expressed [Oryza sativa"
Score 743
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13484
GCACGGTCGACCTCTGCTTGCTCTGCTTTCGCTACTCCTCTGCATCTCCCTGCTCCGGGCCAGCTCGGCGGCTTCCGTCACCGCCGGCAACCCCGACGGC
ACGGAGCTCTGGGGATTCGTCGAAGTCCGACCAAAGGCCCACCTGTTCTGGTGGTACTACAAGAGCCCCCAGAGGGTGTCGACGCCGTCCAGGCCATGGC
CGACCGTCCTCTGGCTACAGGGCGGTCCCGGAGCGTCGGGGGTGGGCATCGGCAACTTCATGGAGATCGGGCCCCTCGACGTCAACCTGAAGCCTCGAAA
CTCGACGTGGCTGCAGAAGGCCGACCTCATCTTCGTGGACAACCCTGTGGGGGTCGGGTACAGTTACGTTGAGGACGACAGCCTGCTGGTGACGACTGAC
TGGCAGGCGGCCACGGACGCCACCACGCTGCTCAAGGCGCTCGTCAAGGAGCTGCCCACCCTGCAGCAGGGGAGCCCCCTCTTCCTTGTCGCCGAGTCCT
ACGGCGGAAAGTACGCGGCCACACTCGGCGTCTCCGTCGCAAGGGCCGTCCGTGCCGGCGACCTCAAGATCAAGCTCGCAGGCGTCGCGCTCGGGGATAG
CTGGGTCTCGCCGGAGGATTTCACGCTCGCTTACGCGCCGCTGCTCCTGGAGGTTTCGAGGCTCGACGACAACGCCGGCGACGCCGCCAAGAAGAAGGCG
GCGACGGTGAAGGAGCAAATCGCGGCCGGGCGGCTGGCCGACTCGCAGGGGTCGTGGTCGGAGCTGTTGGATTTCATTGACTCCAAGAGCGCCAGCGTCG
ACATGTACAATTTCCTGCTCGACGCCGGCATGGACCCGGTGGCGGCGGACCTACCGGCGACCTCGTCGGCTCCGACGACGTCGAGCAACGCGCAAGTGAT
GAAGTACTCGACGTACCTCGGCGGCAGCCATGAGGAAGCCGGCTCCAACACCACCAACACCCTCGGCGGCATCATGAACGGGGTCATCAAGGAGAAGCTC
AAGATCATCCCCAAAGACCACGAGTGGCACGAGCTGTCCGATCCCGTCTACAACGCGCTGGTCAACGACTTCATGAAGCCACGGATCGACGAGGTTGACG
AGCTGCTGTCTTACGGTGTAGATGTCACGGTTTATAATGGCCAGCTCGACGTGATTTGCTCGACCAAGGGCGCGGAGGCATGGGTGCAAAAGCTCAAATG
GGACGGGCTGAAGAACTTCCTGAGCCTGCCGCGGCAGCCTCTGTCCTGCGGATCATCCAAGGTCACCAAGGCCTTCGTCAGGTCCTACAAGAACCTGCAT
TTCTACTGGATCCTCGGCGCTGGCCACTTCGTGCCTGCCGACCAGCCTTGCATTGCGCTGAGCATGATCGCTGGCATAACCCACTCTCCAGCCGGCTAGG
TGAGGAGGAGGACCCGGATCAGATCCTGTCTGCCGGGTAGGAAAAGGAAACTGAAGATAGAAGTATAGAAAGAAAGGTTGTGTGTACTTTAAAGGGCGAT
GAAATTGATTGTAAGGTGCGTTGGTGTGTGAGTGGGGTTAAAGCTCGTCCGT
page-top