Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1347  (registered. 2012)
Contig Information
Length 1105 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218198023|gb|EEC80450.1|| hypothetical protein OsI_22651 [Oryza sativa Indica Group]
Score 419
Evalue 4.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1347
GCCTTTGCGTTGGGTAAGTTGGCCGGCCACAAAACGTCAGGAAATAGGGACAGCAGACAGGCACCCCATCAATTATTTCCCCACAAAAAAATAACAGGTA
TAGCATGTGACGGGGGAAGAGCCTGTAGTAAAGCTTAAGCTAGCGTGCATTTTTTTAGTCTAAAAATGCCAACAACAAATTCTGGGGTTTCGTTCTTTCG
ACAAACGCTGGCGGCCCAGATGGTGGCTGGAAACCGGTACACAGGTCAAGCAGCGCTCCATGTTCAGATGGCCTCGGCTTCGTCGCCGCCCTCGACAGAT
TAGAGCTATCTATCTTACGTGAATGATCATCTTATTCAAGAGATCCTTGTGCTCCGGAAAATATTCCAGCAACTCAGCTTTGGTCACCCACGCGTGGTCT
TCGCACCTCCTGATGTCCAAATGCGTGGTGCCGATCACTTGCGACTTGAAGAAGAACCGCTTGAATGGTGAAACACTGGAATCCTCTTTTTGTTCAGTTA
CCATGTGAGCCATTGGAGCGTTGCCAACAAAATATGTATTGTCAAGTCCGCCGAGAACAGATTTTAGGGCTGACTCGGCACACAAACGCAAAGAGTCTTC
ATTTTCGTACACTTTTTCTGGGAAATGCCAAACAGGTTTGCCATCAGGAGCCCCAAAAGTTTTGCCATACAGGAGAAGATATATCTTATTATCCAGAGCT
CGTTGTAGTGACTTCCTGTCATTTGCTTTGTCGGCTTCTGTGATTCTTGGAGCAGGCACATAGTCTATCTGATAATCACCCTTGCCCCTCGCGTCCGCCT
TGCCTAGGACATCGTCGGGGTACTGCCGCCTGTACTGTTGCCTCCACCGGAACGAGAATTCTTGGAAGGCGTAGACGACGGGGTGGATCTTGGGGATGAC
GACGGGTAGGCGCTCGAACACCACCGACGCCACGATCTTCCCGTCGGCCCCTTCCTTCGCGGCCGCCGCTGGGACCGAGGAGGAGCTGAAGCCTCGCGGC
CACCGGAGCGACCTGAGGTGGAGGCTCGCCGGCGATCGCGGCAGCATCGTGTGGGATGGGAGGTGGGGGCGTTGGGGTCGGGGTTCGGGTCGCGCCGCAA
GAAGG
page-top