Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13457  (registered. 2012)
Contig Information
Length 820 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226506726|ref|NP_001141599.1|| hypothetical protein LOC100273717 [Zea mays]
Score 343
Evalue 1.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13457
AATAATCATGATTTTTAAAATTTCAAAGCAAACCATGCATCATACATCCATCCAATTCTAGCACAAGTAAAATCATTTCATCATTTGGCCTAAGTAACAA
ACCAACATCTCTCAGACTAAATAACAGACAGACTAAATAGGGTACAGCTGCTGCTCCTGCTGCCTCCCTCCCTCGGCAGCAGGGCAGGGCAGGGCAGGCA
AAAAACAGCATCACTTCAAGCAAAACATTCAAGGATTCCATCTTCTCCTTCCGTCCTCCTTGCAATGTCGGCGCGGGTCTACGACGGCATGTATGTTGAA
GTGTCAATCTGCTCAGGCAGCTCCTTGATGTCCACCTCAAACCGTTCTTGCACCTGGTTAAGGACGTCCGAGTCCGAGGCCGACGAAACAAAAGTTATGG
CAAGCCCCTTGGTGCCAAAACGCCCAGCCCTTCCAACCCTGTGCAAGTAGGTATCAGCTGAATCAGGCATGTCATAGTTTATCACAATGTTGACACGCTC
AATGTCGATCCCTCTGCCAACCAAATCCGTCGCCACAAGAATCCTCTTGTGCCCTTCCTTGAAGTTCTTGTATCGGGTCAGCCTCTCTTCCTGGGTCATG
CCAGAATGGATGCAGATTGAAGGGAAGTTGCATTCACAAAGCAACTTGTTCAGCTCTGCAGCCCTGCTAACGCTCTTCACAAATATCACAACTTGGTTGA
AATCGAGAGCATCCAAGAGATCGTTCAATTTTCGGTTCTTCTCTGACTCAGTCAATTTTATGTAGTGCTGAACAAGACCGTNNNNNNTCAACTTTGCCTC
ATCATCAACATAAATTTCCA
page-top