Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13423  (registered. 2012)
Contig Information
Length 1091 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_DPA20 Seed DPA20 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440315|ref|NP_001044437.1|| Os01g0780500 [Oryza sativa (japonica cultivar-group)]
Score 398
Evalue 7.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13423
TTTTTTTTTTGGGCGAAATAAACTAGTTTTAGCACTTCACATACATTAACCATAATATAGTGACATTGCAAGCAAGCTCGTCAGGATAGTGATGGTGGAA
GTTGTATCTCCCAAAAGATTAAGCTACATATAAAGCACATGGATCTGGGGCCTAGGAAAGAAATGAAGCACTCGTATATATTACAAGAATGCAAGAAGAT
CTATAGCTACAGGTATTCTCTCTCAGCCACCCACAGATATGTATAGGAATGTACAAAGACAAGACGCCATCAACGATTGGCACATCCTATTCTCATCCAT
TCATCAGCGAGACCGCTCTATCAGAAGGCCGATCTCATGGCACCACGTGCTGCCTCTTGCCTCATCTGCGCAGCCTTTCCACTTCCACGGAAGTACATGT
ATACTTGCTGGATCACCACAATGCTGAGCAGTGCTTCAAGGCAGAACAGTCCGAATCCAACAAAGTAAAATATCCCCACAATAACATTGCTGCCTATGAC
GTCAATTGCCGGCAAAAACCCAGCGATAGATTTTCCTTTGAAAGGAAATGGGGGAGACACAGCTGACCAGATGCAGAATATTATATGGATCAAGTACAGC
AGAAAAAACCATCCAAACTTCAGAGCGCTTTCAGTCCTCATTGCATTATAAAGTGGCCGATACCATAACACATAGGCCCCAGGGACACCAGAGATGAAGT
AGATAATTGCTAGCAACCAGATGACAACACCTGCCCCTTTAATCCATGCTGCGGTAGTTGCAATGATGTTCCAAAAGAGGCATAATGTCAATCCCAACAA
TGAACAAAATGCAAGGTACTGCATCCTTTGTAGGTGGATTGGTATCTCATTTGAAATGTCATGATGAATGATGGGCATAAAAGGTGGCCAGTTTTTCGTT
TCAATAACAATACCAGCTCTAGCTGCAGCTTCTTCCCTTCTTTTAAGTTCATTCATGTTAAGAATTTTATCATCTGATTGTCTGGGTTAATGAAGAGATG
GCTATATGAAACCTTTTGCTTTAAGTCCTACATTACATACGCACCGCATAAGCAATCAACGACACGCTGTGAAAGAATTCAGTAATCAATT
page-top