Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13421  (registered. 2012)
Contig Information
Length 673 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242042345|ref|XP_002468567.1|| hypothetical protein SORBIDRAFT_01g048160 [Sorghum bicolor]
Score 261
Evalue 6.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13421
CAACCAGCAACACACATTCAAACGAACGCCCGCGTTTGCTGCCTGTTTCAACTGACGTTATATACAACAAATATGGGCCCAAAAATGCACTACCTATTAC
AGGTATGCCAAACCAAACGAGTTCCTTCAATCGCATTCACAGGACTTTTCAGTGAAACGTCTTCCCGCAGATCTTCTAGCTCCTATACCGCTCAGATCAG
CGCAAACTTCCGACTACATACATATATATGGGATGGATGTGACTTCTCCGAGTTTAATATGCTCTTCATTCATGGACCTCTTGCGCTCTTTTGCCTCTTC
TCTTCAAGTTGTGAGGCCTCGTTCAACATGTCAGTGGCGTCACTCTGCATGTCTAGCTTGGACAGGGCGACCGCCTGCATGTAGAAAGCTGTGGGCCAAT
CGGGATACACACACTGCGCTTGCATTGCGTCCCGGAGGGCAGCGTCAGGTTGGTCACACATCAGGTGGCACAAGCTCCGCCTGGCGTAAACCGTTGGCGA
CACCATTGTCCCGACATCAACAAACTGAGTATAACAATCTATGGCTGCTTTGAAGTCCTTGTCTCGGAAAGCAAAGTCGCCCTGTTTCCGGGCGTCCAAC
ATATCCCTCATCTGCTGTGTCCATTCTTGGAACGATAACTCATTACTCCCTTCATCATCTCTGTAATGCATCG
page-top