Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13419  (registered. 2012)
Contig Information
Length 559 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig13419
TTTTTTTTTTCCAGTGACATTTTTTTTTTGCGACTCAACATTTTTTTTTTATCAGTATCAAAACTTATTCAGAGCGCCAGAACAAAGTCGACAAACAGCA
GGCTACCAAAGGGAACAGAGCAAACATGGCGTCGAGAACATTCATGGGGGAACAGAATGAACATCCGCGTCAGTATTATTCATGGGGGGCAGAAGCAAAA
GGTGGCATTGGAAGGCAGAGATAATTTGTATGTTCTATATCATAGAGATACTTCGTTCCATGTCTAGTTCACATGTTGACACGTCGAAAGTGAGCCGTGG
TCTGCACTAGTTCTTGCCCATCATGGCTCTGTCCTGCTGCCTCAGCCTCTCGCCTTCGCGAGAAAGATAGCCCTGGAATTTCTCCTTGCCGCCGAAGAGG
AAGATCCCGGCGAGGCCGGCGGCGCCGACGCTGCCCCAGATGACGACCGTGGAGGAGAGCAGGGACCAGTTGCGGTAGATCATCCTCGCTTCTTCCGCGG
CGGATTGGATTTGGATTTGGATTCGGGGGAGATCGGAGCAGAGACCGCAGCAGGTTTGG
page-top