Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13390  (registered. 2012)
Contig Information
Length 887 bp
Clones alternative view 72 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125601078|gb|EAZ40654.1|| hypothetical protein OsJ_25125 [Oryza sativa Japonica Group]
Score 216
Evalue 4.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13390
TTTTTTTTTTCATGTAAACATAGAGCCATGGGAATACAAACATAATATGAATCCATTACAATCACTTGCTTTTACAAATCAAGGATAAAACTCAATGACA
ATACGGAATGATCAGAGTTTACATATAGGATACAGATATGTTTCTTTGCACTAACTTTTTTCCTTAGCATGGCCAACTCAATATCACCATGTGTTAACAT
GCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCATTTGCTACTTCTCTTTACATCGGAACTATGGAGGCGAATAACATAGAACCATAACCTAAA
CAAAACGCTAGAACATGATATGGGATAAAATATTCATGACTTGATACTTCTAAGGACAAAGCACATTTCAGATATATTTCTGGTAAGGGCATAAGGCTCC
TGTCATGCCGTCTTATTGGTTTGGCTTCAGGGCGGCATTCGGCCCTAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTGGTGTTGCATCAGAA
GGAGGAGCTTGATATGGTGCCTTTGCATGGAGACGATCCTTTCTCTTCTCAAGGAATCGGTGAAGTGACGCCTTTCTAGCAATTGGCAGATCAGAAGCAT
TCGGACGAGCAGGCTTAGGAGCATCAACCGGACCAGTAGGCAAACTACTTGCTGGGGCCAGCACGGCCGTCTGGACCTTGTCGGTGTCTGCAGCAGTTGT
GGTCGCAGAGACGTTCTGAACAACAGGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTTGCCTTGTCGGCTGGGAAATCGTTGAACACGAGCACCTTC
CCACCATAGAAGATGGTCAGCTGGCTCTTGTCTTCCTCCCTGGTAGCATCAGGGGCGGCGGCGTCCTGCAGGCCGGCGCTCTGCGGG
page-top