Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13364  (registered. 2012)
Contig Information
Length 739 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|118154067|gb|ABK63978.1|| ZIM motif-containing protein [Triticum aestivum]
Score 240
Evalue 1.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13364
AGTACAAGACTTGGTTTTGAAGACTTGGCCTCATACAAATGCATTTCTAAATGCTGTGGTACACCATACACAGCATGTGGAAACACAAAACAACAAATGT
AAGGGGGTCATAATACTCATAATACGCTCCAGAAGAACGTAGACTGCTACTTGTACTCTTCATTCATGCTAACCTGTCACGGCGCTTCTCCAGGAAGCGC
TGAAGGGAGTGTCTCCTGGCGATGGGAAGATCAGCCTGAAGCTTGCAAATCGAGCCAGGATCCGCGACAGCCTGAGGTTGTCCATTTGCTACAGAAGTGC
TCTGGAGTGAGAGCGACCGCGTAAGCATGGCTTGGATAGCATTGGTCGCAGACATCGCTGGAGGCTTAACAGCAGTGGTGCCATTGCTTTTTGAGGCCGC
AGCTGCTGCTGCTGCAATGAGCATGATTGCTTGAGCCTTCTCTGGTGGCACTGAGTCATACACACATACTGACCCACCATAAAAAATGGTAAGCTGTCCC
GGATTTGCTGGAGGGCTCGACATTCGCAACATTCCAGACCTGCCGTTGGCGAGCGGGGGTCGGCCGGTGAGCCCTGGCTGCTGGGTCTCCTGCTCCTTGT
GCTCCTGCTCCTTCCTCTCGGCTTCCTTGCGCTGGGCCTCCCCCTGCTCCGCCTTAATAGTGGCTGCGCTCCTCTCCAGCNNNNNCATCTCCGTCTCGGG
TCTCAACTAACTGCTCCTCTCTCTCTCCCTCTCTCTCGT
page-top