Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13359  (registered. 2012)
Contig Information
Length 2371 bp
Clones alternative view 725 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 3
Wh_r Root 1
Wh_SH - 4
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 11
Wh_KMV Shoot grown with continuous light after cold treatment 20
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 34
Wh_VABA Shoot with ABA treatment 55
Wh_VHS Shoot with heat shock treatment 50
Wh_VWD Shoot grown with dessication 25
WH_XI Two-week old seedlingsi22 16L-8Dj 12
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 10
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 10
WH_XN Leaves, plant was grown at constant 23 74
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 21
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 53
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 54
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 63
WH_XF Seedling, infected with leaf rust 48
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 69
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 49
WH_XV Leaves, plant was grown at constant 23 10
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 16
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116283512|gb|AAH29790.1|| Unknown (protein for MGC:35458) [Homo sapiens]
Score 852
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13359
TTTTTTTTTTAGTACTTTTTTGTTCTGTTTGCAATAAAGCAGAAGCAGTCTCCACTGAAGGAATGAATACAGAGAGTGACAAATGATAAGTAGTTCTATT
TGTCTTTACCAAATAGGTATACTCAATATCTTTTTATATTAACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTAGGTACAAAGGATAAAA
CATCAGATATTAAATTGGCATGCTTAAAAGGTGTAAAGGCAGCTCCCGTCGTCACTCCTCGCCGTTGGGTCGAAGTTCTTGGCAGTCTGGTCGGTGCATC
CTGCCGGTACAGGCAAAGTACCTTGCTGTGCCCCTTTACCTCCTCCTATGCAGCAAGAGATGGTGGGTGTGTATGGAGAATGTTCTAACCGTAGAAGGAA
CCAGTCTTCATCGCATCCTGGTTAGCATCACCCAGAGCTGCCTGGCTCATGTAGGTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCCTGGACAA
GCATGTGCCCGTACTCTAGCAGCTTCTCCACTGTCATCTTTGGCTGCTCAAAGGTCACGGGTCCGTCCCGCGAGTTCACCAGCCTCTTGCCAATGTTCTC
GATACCGGTAGAGGTCACCCACTTGCGCACCTCGTCGTCGTACACCCGAGCACGCAGAGCACCGAAAAAGTCGATGGATTGTCCTGGGAAGGTGTCGACG
ATCTTGACGACGGACTCGTCGCTGACATTGTCGGTCTGGAAGATACCCTTGCAGACACCGATACGGTCGTCGCGGGTGGGAGCCCAGTAGAACTTCTCCA
TACGGCCATCACGGATCAGAGGGGCGTACAACGTCGAGAAATCGTTACCAGTGACGACGATGGGCACACGAGGGTTCTCCTCCTTGTTGTACATGCCTGG
GAGCTGCACGTTGGTGGGGGCATCGGCGATGTTCATGAGGGTGGCGTTCACCATCTGGTTGTTGACGGTGTACTGTGTGGTCCCGCCCATCCGACCCGCA
CCAGCGTCAAGATCGTTGATGAAGAGGCAGCACATCTTACCCTTCTTGATCATGTCTGCAGCCTCACGGTACCGCTGNNTGATGAGCTTGGCTAGCTCTC
CGGCGTTGCCACTCTCCAGCTCTCCGGCACTCATCATGATTGGGTTGATGCCCATCTTGGCGAAGACAAGCTCGCACTGGAATGATTTTCCTTGACCCTT
GCCTCCCCAGATACCCAAGATGAGTGGGATCTTGATGTTGGGCAGGGTCATGAAGTTCTTGGAGAGATGGACAACAAGCTTGTCCATGAAAGCAGGAGCG
ATGTAGAAGCCTCCCATGGTGTTGTCGAAGTCGTACTTCTTGAGTCCCTGGCTGACGTACTCGTAGGAGCTGAGGACGGCCTCGTGGGTGCCGTCGCCCG
TGGGCGCCTGGAAGAGCGAGTCCACGATGCCCTTCCCTCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTACGCAAGACCCTTCCACTTGTCCGTGTT
CCTCTTCTCGTCGAGGTTTTCCGCTGCCATGACTGTGAACCTGTTGGCCTTGGAGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGC
TTCTTCCCAAGGAAGTTGGTCGGCGTAGAAGCCGGGGCACCGACGGTGGAGGAGAAGGCAGCAGCCATCTCGGTGCTGCTTGGTCGACCTTGCTAGCAAC
GGTGGATGCGCGGCTGTGCTGGTGATCGGTGATGAATCCTCGTGCCGAATTCGGCACGAGGCATTGCTGGGGACAATGTTGGGCTTCTGCTCCGTGGTAT
GCAGAAGGAAGACATTGAGAGAGGCATGGTGTTGGCAAAGCCCGGTTCCATCACGCCACACACCAAGTTTGAGGCTGTTGTGTATGTGCTCAAGAAGGAG
GAGGGTGGCCGGCACTCCCCATTTTTCCCTGGTTACCGTCCGCAATTCTACATGCGGACTACTGATGTCACGGGGAATGTGACAAACATTATGAACGACA
AGGATGAGGAGGCGAAGATGTGCATGCCAGGTGACCGTATCAAGATGGTTGTGGAGCTCATCCAGCCTGTGGCTTGTGAGCAGGGAATGAGGTTTGCCAT
CCGTGAAGGTGGCAAGACCGTCGGTGCCGGTGTCATCAATAATATCATTCAGTAATGTGGATGGAGGATATCCACCGTGAGAATTTTCCTCATTTACTCT
TTTGCGAAATGCTATGTAGTTGTTATTATGCGTTTAGGGAAGGCTCTTGTGAAATTGTAGTATGGCACATTTTTCTTCAAGTGAAATTGCATACTTTGTA
GTATTCACGACAAAGATACATCTTGATCTGCCAAAAAAAAAAATGTGCTTGACTGTTGGCCAAAAAAAAAA
page-top