Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13324  (registered. 2012)
Contig Information
Length 1338 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224760833|gb|ACN62414.1|| malate dehydrogenase [Bambusa oldhamii]
Score 650
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13324
TCTCTTCTCTTCTCTCGTCGCCTCCCGAGTCTCCGGCAACCACGCCAGCGCGGCCATGGAGCAAGGCACCGACTCCGCGGCGGCGAGGCGGATGGCCAGG
GTCGCCTCCCACCTCTGCCCGCCCACCTCGCAGATGGAGGAGGTGGCCATCTTGAAGGGCTCTAATTGCCGTGCAAAAGGTGCGGCACCAGGGTTCAAGG
TCGCAGTCCTGGGTGCATCTGGTGGGATCGGCCAGCCGCTCTCGCTGCTTATGAAGATGAACCCTCTTGTTTCGGTGCTCCATTTGTATGATGTTGTCAA
CACACCTGGTGTCACAGCTGACATTAGCCACATGAACACTGGTGCTGTGGTGCGTGGCTTCTTGGGTCAGCCACAATTGGAAAGTGCTCTTACTGGAATG
GATCTTGTGATCATTCCTGCTGGCATTCCTCGGAAACCTGGGATGACAAGGGATGATTTGTTCAACATCAATGCTGGGATTGTTCGGACTCTTTGCGAGG
GAATTGCAAAATGCTGCCCAAATGCGATTGTGAATGTGATCAGTAATCCTGTAAATTCTACCGTTCCGATTGCTGCTGAAGTATTTAAAAAAGCTGGAAC
ATATTATCCTAAGCGTCTATTGGGGGTGACAACACTTGATGTAGTGAGAGCCAATACCTTTGTGGGAGAGGTTCTTGGACTTGACCCCAGAGATGTCAAT
GTTCCTGTTGTTGGTGGGCATGCAGGAGTTACGATATTACCACTCCTTTCACAGGTGAATCCTCCCTGTTCGTTTACCTCAGAAGAAATTAGTTATCTCA
CTTCTCGCATACAGAATGGTGGGACAGAAGTAGTTGAGGCGAAGGCAGGAGCAGGATCAGCAACCCTTTCCATGGCCTACGCAGCAGCCAAATTCGCGGA
CGCCTGCCTGAGAGGGCTGCGCGGCGACGCCGGGATAGTGGAGTGCTCTTACATAGCCTCTCAGGTGACGGAGCTGCCCTTCTTCGCGTCCAAGGTGCGG
CTGGGCCGGTCCGGCGTCGAGGAGGTCCTGCCGCTCGGCCCGCTGAACGAGTTTGAGAGGGCCGGGCTGGAGAAGGCCAAGGGCGAGCTGGCCGAGAGCA
TCCACAAGGGCGTCGCTTTCGCCAACAAGTGAAGATGGGAAGAAAATCCTAGCACGCAGCTCCGTATCTTTCGCCGAAATGCTCCAAGGCCAGCATAGAA
ATCTGAGATGCCTTTTGCTTCCTGCCTGCTCCCGCCTGGGAGCAACAGTCCCCGTGTGATGTGATGTAAATCTCCCTGTCATAACAATAATAATAATAAT
AAAATTGTACTGTATTTTGTACCGGTATAAAAAAAAAA
page-top