Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13313  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125558989|gb|EAZ04525.1|| hypothetical protein OsI_26675 [Oryza sativa Indica Group]
Score 191
Evalue 7.00E-47
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13313
TTTTTTTTTTGTAAAAGCACGGCCGTGGATTGGATTGCAGTTCAAACCAACCGGTGATTTTTCTTTTCTTCCAGAGAACACACAATCTTTCTTTCGTATC
CACCGGAAGAAACCGAGTCCGGAATGACGATGATGATCCCTGACTTGGCACTCACACTCACCACACGCGAATTTGGTTGCTTCCTCGCTCTAGAAGCAAC
CAAATTGGTACTAGAAACTAATAAAAGTGAAAAAAAACAGTGGGGGAGAATGAATTTACAGGGAGGCTTGGCTCCGCCACCATCGTCATCATCTCGCTTG
AGGTTGAGGGAAATGTACACTCGCTCGCGGACGCAAACTCGCTGCTGGCTCGGCTATTTACACGGGCGGGCAGGCACGCCGGCCGGCTGCCCAGCCCAGC
TCGTCTCGCTCTCGCCACGGGGAAAGGGGAAAACGCACGCACGCACGCCACCTGGCATGGCCAAGGTGGAATTGGTAACTGAACGGTATCATCACTCCGC
CGCAACGATCGCCGCCGGCCTGGTGGCTCGCAGGCTCGCGCTTCGCGGTTGCCGCAGCATCTCGATCAGCGCCTCAGCCTTGGTTTTGAGCTTGGGGCGT
GCGGAGGAGGACTGGGAGAGCGCGACGAGGGGAGGGATGGCGCCCTCGCGGGCGACCATGGTGCGGTACGCGGCGTTCTCGTCGCAGATCTGGAGGAGGG
AGAGCGTGGCGATCTCCTTCTGCCGCGAGGTCCCGACCTCCACCATCTCCACCAGCACGGGGATGCCGCCCTCCTCCACGGTGGCGGAGCGGCCCTCGGC
GAAGCCCACCAGGGAGTGGAGCACGTAGGCGGC
page-top