Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig133  (registered. 2012)
Contig Information
Length 2763 bp
Clones alternative view 296 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 6
Wh_oh Pistil at heading date 1
Wh_r Root 12
Wh_yd Spikelet at late flowering 2
Wh_SH - 1
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 11
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 11
Wh_VWD Shoot grown with dessication 9
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 13
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 14
WH_XT Roots, 18 day old plants were grown hydroponically 19
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 30
WH_XB Root 16
WH_XC Root, treated at 50 microM Al for 6h 18
WH_XD Root, treated at 50 microM Al for 6h 25
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110288667|gb|ABB46862.2|| Enolase, putative, expressed [Oryza sativa (japonica"
Score 858
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig133
TGTTTTGAGAATAGCAAACAAAGATGAAAGCAAGTTTCTCAGAAGCATGCTTTCTGCAACAAGTAAACTAACACAATAACGGCAAAGATGATGCGCCAAA
AACTAGTATTACACATCCAAAAGGTTCAGGGCCGAATCAGGTACATATCCACAAGGACCAAAATTGGAGCAAGTTTGGGGGTACATATCCGTTCCGTTCA
CATAAAACATGCGCGGCATTCATTATTGCTCAATCCTAAGAGCTTCAACCAGAGTTCATTCCGGAGGTTAAACACACCCATTTTCACAAAAACTCGTGCA
GATCCCATCTAGTAGGGCTCCACCGGTGCACGGAACTTGAGGCCAGCGTACACCGCGGCATCGCCCAGCTCCTCCTCGATCCTCAGAAGCTGGTTGTACT
TGGCAAGACGCTCTGAGCGGCACGGAGCCCCGGTCTTAATCTGACCCGTGGACAGACCAACAGCCAAATCAGCAATGAATGTGTCCTCGGTCTCACCACT
CCTGTGACTGGTCATCACACCCCAGCCGGCATGTTTTGACATCTTCACGGCCTCGATACTCTCAGTGACGGATCCAATTTGGTTAACCTTGAGCAGAAGA
GCATTGCATGACTTCTCCTGGATTGCCTTTGCAACTCTAGTTGGGTTGGTGACTAGAAGGTCATCACCAACAATCTGAACTTCCACTCCACATTCTTCAG
TCATCTTAGCATAGTGCACCCAGTCATCCTGGTCAAACGGGTCCTCAATCGACACAATGGGGTACTCGCTCACGAATGACTTGTATACGTTCTTCAGGCT
ATCTCCAGATATCTTCTGGGAACCATCGTTGTTCTCTTCCTTGAAGTTGAGGTCATAGGTTTTGTCCTTGTCATTGTAGAACTCTGAAGCAGCAACATCC
ATTCCAATGACAACCTTGCCGGTGTATCCAGCCTTTTCAATTGCAGTCTTCAAGAGCTCAAGGCCCTCCTTGTTCTCCTGAATGTTAGGAGCAAAACCAC
CTTCATCTCCGACATTGGTGGCATCCTGCCCGTACTTCTTCTTGATAACAGACTTCAAGTTGTGGTACACTTCAACGCCCATCTTCATTGCCTCCTTGAA
TGAGGTAGCTCCAGTAGGAAGGATCATGAACTCCTGCATAGCAAGCTTGTTTCCAGCATGGGATCCACCATTGATGACATTGAACGCAGGAACGGGCAAA
ACCAATTGCTTGTTGCCAGCAAGGTTGGCAATGTGCTGGTACAGTGGAATCTTCTTGACGCTGGCTCCAGCTTTGCAAACAGCTAGTGATACAGCCAGGA
TTGCATTAGCACCAAGCTTTTGCTTGCACCAACCCCACTCATTCTTGGTTCCATCAAGCTGCTGAACCATAAAGTTGTCGAGCTCAGTTTGAGCGGTAGG
GTCCTTGCCGACCAAAGCGGGTGCAATAATGGAGTTCACATTGTTAACAGCCTTGGAAACACCCTTGCCCAAGTAGTCAGATCCACCGTCCCTCAGCTCC
AAAGCTTCATAGACACCAGTTGATGCACCGCTGGGAACGGCGGCCCTGGCGAAGGTTCCATCTGAGCAGCACACATCAACCTCGACGGTGGGGTTGCCGC
GGCTGTCGAAGATCTGGCGGGCCTTCACGGACTGGATCGTCGCCGCCATGGCTGGTCTCGCGTGGCTTGGAGAGGAAGCCGAGATCGAATCGAATCGAAT
CGGACCAGATGGAGCGGAGAGCGAGAGGGGTGCGGGTTCGCCTCGTGNNNAATTCGGCACGAGGCAGCAACCACCAGTGCCTTACACACTCTCGATCAAC
AAACTCTACCCGATTAGTTGCATAGCAAGCAATGGGGTGCTCCAAAACCCTAGTAGCTGGCCTGTTTGCCATGCTATTCCTAGCCCCGGCCGTCCTGGCC
ACCGACCCTGATCCTCTCCAGGACTTCTGCGTCGCCGACCTCGACGGCAAGGTGGTCTCGGTTAACGGGCACACGTGCAAGCCCATGTCTGAGGCCGGCG
ACGACTTCCTCTTCTCGTCCAAGCTGGCCAAGGCCGGCAACACGTCCACCCCGAACGGCTCCGCCGTGACGGAGCTCGACGTGGCTGAGTGGCCCGGTAC
GAACACGCTGGGTGTGTCCATGAACCGCGTGGACTTTGCGCCTAGAGGCACCAACCCGCCACACATCCACCCGCGTGCCACCGAGATCGGCATCGTGATG
AAAGGTGAGCTCCTTGTGGGAATTCTCGGCAGCCTCGACTCCGGGAACAGACTCTACTCCAGGGTGGTGCGCGCCGGAGAGACCTTCCTCATCCCCCGTG
GCCTCATGCACTTCCAGTTCAACGTCGGTAAGACCGAGGCCTCCATGGTCGTCTCCTTCAACAGCCAGAACCCCGGCATCGTCTTCGTGCCGCTCACTCT
CTTCGGCTCCAATCCTCCTATTCCGACGCCGGTGCTCACCAAGGCGCTCCGAGTGGAGGCCGGGGTCGTGGAACTTCTCAAGTCCAAGTTCACCGCTGGG
TTTTAATTCCCGGGAGCCTTCCCTGAAATGATCAATATCTAATTCAATTTATGCATGGTAGCAAGATTTAATAATTCTCAGCAGAACACATGTAGTCAAG
CTTGGGATTAATTTGGCATGCAGTTGTAATAAAATTGAATAAGTTAGCCTCAGGGTTTAGCCTTCAGAACCAATATGAGGAATCGAATGTACTACTTTTT
ATTGTCGTCTTTGTCCTTTCATTGGACGGAATATATAATTAGCATTTTCGTATAAAAAAAAAA
page-top