Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13269  (registered. 2012)
Contig Information
Length 764 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125603988|gb|EAZ43313.1|| hypothetical protein OsJ_27909 [Oryza sativa Japonica Group]
Score 232
Evalue 3.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13269
TTTTTTTTTTGAACATAAAAACATAATTATTTCGTGGCGCCTCATAGGGTCACAAGATCATACCTAAATACATCATCTCAAGACAACAATAAACAACTAA
CTGGCACAGAAATTCAAGCTGAGACGACCTACACAGCAGCTGCAGTTACCACTCATACCAGCTACATTGCTCCCTAATTAAACTTCTGATTTATACGACT
AAATGGGAGCTAGTTAGACAGAATGACATTTCTACTTCCTGCCAGGGAGGCAGTTCACCGACAGTCTATCGATGTCCGAATTCGGTCAAGGATGCTGAGT
TCATTTCCAGGGCATGCTGGACAAGATCGGCGGCTGGTTATTGTTGTTGGAGGCGTAGCCTTGATGTCTCGGGCTTGCGGTACCACCGGACAATTCGCTC
AATGTGCCTCTTGAAGGGGGGCTGTTGGCCGCCATCCCAGTGCTCGGAACGACCTTCAGTGGTACGGGCTCAGAAGGAGCCTGCGGCTTTGGCTCTTTTT
TCCCACAAGCATTGAAGCTTCCCACTACTATCTGGATTGGAGAAGCTGCTATGAGAAGTCCTGCGACCCCTCCACCCAAGAGACGACCGTCAGGACCAGC
CAGCGAAACGCTGAGCCCCCCTGTTCGGGTACGCTGGCCTCCGTTGTCCGTTACAAAGATCGACCCAGAGAGTGACAGTATCTCAAATCGGCCCTCATAT
GTTACAGTTCCACCTGATGTACCAGTTTGACGNNGTGTTACATTTGATATGGAACCATTTGCTG
page-top