Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13238  (registered. 2012)
Contig Information
Length 947 bp
Clones alternative view 65 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 2
WH_XN Leaves, plant was grown at constant 23 26
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 7
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100238|gb|AAX13288.1|| senescence-associated protein [Triticum aestivum]
Score 332
Evalue 5.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13238
TTGCAGATACCGTAGCATACATGTGTTATTTTGTAATGGGCCAGTTTACAGGAGGTCAGGTGAAGAACGGAAATTCTAACATTAATATAGCACATACATC
CTATACTACCTCTATACCGAAATACTTGTAGTTGGGGGAACTTGTATTAGCTTCCCCAGCTACAAGTATTCTGGTACGGAGGAGTAGATCATATCAAACT
CCATTTTGCTTATTCAGTGCACTGATGTGGTGTCTCGGAGCATGCTAAGACAAATTATGATGTTTCAACCACATTTATAGAAGCCCGCGTCCATTGACCG
GCAGTCCGTTCTCCCTCCAAGTCGAGAACCCTCCGGCGATGTCGGTCACGGCAGTGAAGCCAGAGGAGCAGAGTTCGGCTGCCGCCATGAGAGATCTCTT
GCCACTTTGGCATCCGATGATGATCTCGTCGTCCCTGCCGAAGATCGCCGACACTTGCTCGAGAAAGTGCGGGTTCTTGGCCATTCCTGAGCCGGTGCTA
TACATGTAGGGGACGTTCACCGCTCCTGCCGGATGCCCACCACCGAACTCGCCCTCCGTTCTGACATCGAGGTAGCGGTGACCGGCCAGCTGCAGCTCGT
AGGCGACGCGCACCGACACCGACGGTGGCACGGCCACCTCGGCCTCCTCCGCCCGCAACGCCGCTACCCTGGCGCCGCCGTATCTGACTGAGCCGGGCAT
CCTCCTGGCGGCGGCCACTGAGACCGCCCTCGCCGCCGCCACGACCCGAGGATTCGCCCTGGTGCACGCCGCACTGTGCCGCAGCCTGTAGGAGGTGAAG
GCGAGGGGCGGCCAGTGCGCGGCGGCGGGGAGGGAGACGCCTCGGGCAAAGGAGAACTCGGATGCCATTATCTCCAGTCCGGTCCTCGCTCCTGTTCCTT
CTTGGGACGATGAGTTCAAGCCAATATATATACTAGCTACGATGCAG
page-top