Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13223  (registered. 2012)
Contig Information
Length 1983 bp
Clones alternative view 82 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 9
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 10
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218186618|gb|EEC69045.1|| hypothetical protein OsI_37876 [Oryza sativa Indica Group]
Score 1083
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13223
TTTTTTTTTTGATCAATCAAGAGCCAAAGCCAGCAATGTTTCCTTTCCCCTTAAATTATATATGCATATTACTGTATATTTTATACATACAGTTATAGAA
TTATATACACCTGACCTGACTGCCGCACCTATGAAGAGATATGTGCTGGAAGGAAATGAAAACGCTGTATTGTATATATATGCTTAACAATCTTCTACGT
ATTCTATACAGTACCAACAACTAAACAGCGACCGCCGGGGTTGGAAGCTCCGGCAGTCCGCTCTCGCCATTCAGCACAATGACTTTCCCCTCCGGGTCCA
CATCAACGATGACAGAGTCGCCCTCCTTGACCTCCCCGCCCAAAATCTTCTCCGCGAGGCTGTCCTCCAGGAGCCTCATGATGGCCCTCCTCAGCGGCCG
CGCTCCGTAGCTAGGGTTGTACCCTTCGTCCACGACCCGCTCCTTGAACTTCTCCGTCACCTGCAGGTTGATGTCCTTGGTCTTGAGCCTGGTGAAAACC
TCCTGCAGCATTATGTCCGCGATCTCTTTGACTTCCAGCTTGGTCAGCTGTCTGAAGACGATCATCTCGTCCAGACGGTTGAGAAACTCTGGTCGGAAGT
ACTGCTTCATCTCCTCGATCACCAAGCTCTTGATCCTGCCATAGCTGCTGTCCTTCTCGTCCGAGTCGAGGTCGAACCCGATCTTCCTCCCCCCCTTCTC
AATCACGCTGCTCCCAACATTTGATGTCATTATCAGGAGCGTGTTCTTGAAGTCCACTGTTCTCCCCTTGCTGTCGGTTAACCTTCCGTCTTCCAGGATC
TGGAGCATCATGTTGAACACATCCGGATGTGCCTTCTCAATCTCATCAAAAAGCACAACGCTGTATGGCCGCCGTCGAACCGCCTCCGTCAGCTGCCCAC
CTTCAGTGTATCCCACATAGCCTGGTGGTGAACCGATCAACTTGGACACAGTGTGCCTCTCCATGAACTCACTCATATCCAGCCGGATCATGGCTTCTTC
AGAGCCGAAGTAATATGATGCCAGAGTCTTTGCAAGCTCTGATTTCCCAACACCAGTGGGACCTGCAAAAATGAAGCTCGCAATTGGTCTGTTGGGGCTC
TTGAGGCCCACACGAGCACGGCGAACAGACCGACTTATTGCTTTCACAGCCTCGTCTTGGCCGATGACACGCTTATGCAATGTCTCTTCCATCTTAAGAA
GTTTATCAGATTCGTCAGTCGAGACTTTCTCCACTGGAATACCAGTCCATGATGACACAATGTGCTGGATATCTGATTCATGCACCATCGGCCCCGTCTC
TCCCGACTCAGTCTCTGCTTTGTTCATCTCCTTGCTCTTGTCAATCAAGGCTGTTATCTGGGCCTTCAATTCCATTTCACGATCTCGCAACTCTCCAGCC
TTCTCAAAATCCTGGCCACGGACAGCTTCATTTTTATCTTTCGTTATTTGCTTAAGCTCCTTGTCAAGCTCTCTGGCTTCCTCAGGAACCTGGGCATGTC
GAAGCCTAACACGTGAACCTGCTTCATCAATCAAATCAATTGCTTTATCTGGGAGGAAACGATCACTGATATATTGATAAGATAGCTTAGCAGCTGCAAT
CAAAGAATCATCAGTGTAACGAAGTTTATGATGGATCTCATATCGCTCCCGGAGCCCTCTGAGAATTTCTATGGTCTCATCAACTGATGGTTCCGGTACC
TTTACTGGCTGGAAACGTCTTTCTAATGCTGGATCTTTCTCAACATGCTTCCTGTATTCATCAAGCGTGGTGGCTCCAATACACTGTAGTTCTCCTCTTG
CTAAAGCTGGCTTTAAAATATTAGCAGCATCAATAGCACCTTCGGCGGCTCCTGCTCCTATGAGGGTGTGAACTTCATCGATGAAGAGAATTATCTCATC
GCTCTGTTTGATTTCTTCCATCAGTTTCTTCAACCGTTCTTCAAATTCTCCACGGTATTTCGTACCAGCAACAAGAAGTCCCA
page-top