Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13204  (registered. 2012)
Contig Information
Length 827 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218202681|gb|EEC85108.1|| hypothetical protein OsI_32493 [Oryza sativa Indica Group]
Score 355
Evalue 3.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13204
TTTTTTTTTTGCCACTTTCCAGGCAACTTTACTGTTGAGGTCTCGTCAGCTACAAAACCAGCATATCTGTGCGTAACTCTGTTTTCTGGATTTGCACACT
CAAATATCAGGAAAATGCAGTCCTGGCAACACAGATAAGGGCTTACAATTGACCTGCCCGGAGGTCTCTATCTATGCGCTCCGCGTTAAATGTTCCTGGA
ATCTCCCTGAAGTCTTCATTGAATATGGAGTATGCACTAACATCACCTTGTTGTCGTCTTCCAAGGTTAAGAAGTATGATCAAGAAACCTGTCGCAAGTA
TATATAAAGGTCCCACCTCATACTTTCGAGCAATAGGCGCCAATAGGAACCATAGTGTGATAACAATCCATGCTTTCATAGTGACAGAAAATAGTGCCAT
CAACAAGATATCAGGTAATCTCAGTTTTTCTCGAAGAAATATGAAAATCCTTTTCTTCCACCAGGTTGTTGTTTGAGGTATTTTGAACTTCAGTTCTTCT
TCATCGTCATCGTCATCATCATCATCACGGAGATGCTTAGCAGGTGGTTTAGGTGCCACGGCCACTATAAGGCTATCCCCGTCGCGGAGGTTGACATGGG
TGTCGTCTCCCCACGGTAGAGTCGTCCCCCGGAGGACCAGGCGGAGGCGGTCTTCTGGGAGACGCCGGTCGAGAGCAACGGTGCGGCGCAGATCGGCAAC
CGAGATGAGCGGGGGGAGGCGGATGGTAGTGGGCCGGGACGGACCGACGGCGCGCAGCTTCACCTCGACCGTCTCCAGCTCGTCGCCCGCCGCGGCGGCC
ATGGTCTTCTCGTGCTCTACCTCGTGC
page-top