Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13191  (registered. 2012)
Contig Information
Length 1013 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115446199|ref|NP_001046879.1|| Os02g0492500 [Oryza sativa (japonica cultivar-group)]
Score 245
Evalue 7.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13191
TTTTTTTTTTGAACATAGTGGACACACACGGCCAACAAATATAGTCGATACAATGCATAAGATTTTTAGTAATACAAGTTCATTGGCAATGCAACACATC
ATACGCATCACAGATGAGGTAGGAAAGACTTCTTAAGCTTTTTTTGTACCGGGGCTTTGACCATGCCTTCGAACAATTTGAACTCAAACTTCTTTCCAGC
CTGCACTCAAATTTCGGTAACAAGCTTCTTACTTGCCATCCCTACTTGTTTCAGCAGCATTCGATATTTGCCTGGTTGATGAGAAAATGCCCAGATGCTT
GGAGATCCCACTCGGAAGGTAGGTGTAAGAAGGACCCAGGGGTCTTCCAGAGCCGCCAAAATTAGCCACGCCTTTTACAGCCTTGTTCCTCATATCAAGA
GCAATCACACAGGCCTTATCCCCACGGGGATCAGGCATGTGCATAAGGTAAACAACATCACCGTCATGCAAGCTAAGAGCAGGATAGCCTACACGAATTT
TCTTCAGGCTTGGCTTGGCATCATCTCCCTCCTGCGGATTAGGTAGCATTTGGGCATACACAGGGCTATCCAATGGTACATCATCTGAGCATCTGATAGT
ACAGTCCTCCTCCCAGTTGCTACTACCAGAAGTAGAGCCAATGCTTGAAATTTTTATTTTTTTTGTTGCAGCCATCCAACCTTCACATATCAGGGAGCTT
CCAGTGTCTGAGCCCGGTCTGACGTTACTGTGCATCTCAAAATACTTGATGTAACCTTGGAGAACAGTGACGTTCCGAACATACAACATATAACCCCTGA
CTGGATCGGGCGACAGCGGCGAAGGTAGTGGGATGTAGCGAAGACTCTGGTTGTCAAGGAGAAGGTCACAGATGATAATGCCCCCCCTAAGGTCGACCCA
ACCCACTGAACCAAGCTCCCCTCCAATGGTGATCCCCTTGNNNAAGAGCGGAACTCAAAATCCTTGGGCGAATCAAGAAGCATCAACTTGATGTTCCATG
CCTTTGTCTTGGA
page-top