Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13190  (registered. 2012)
Contig Information
Length 657 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196685|gb|EEC79112.1|| hypothetical protein OsI_19745 [Oryza sativa Indica Group]
Score 209
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13190
GCCAGCAAACAGAATCATAGGTCCACAGCCAACTGGTGTATCATTATTTATTGCAACAGATGGAGGGAGAGAAGAAAGACTTGCTATCGGAGAACACAAT
AATCAACGGAGCAAACTAGGATCATTCACCTACTGGGAAAAGACAGGTCCTTTTCGGGGAGCGTTCCTTCTGGAGACAATGCGTGTCAAAGGGGTGAACC
AAGAAACCGCTGCAAGCAAATCTTACTTTGCTTGAGGATGCGAGGCGATGAAGTCAACTGCTGATTTGATGGAATCGATCTTCTCTGCCTCATTGTCGGG
GATCTCGAAGCTGAATTCTTCCTCAAAGGCCATGACAATCTCGACGGTGTCCAGGCTGTCCAGCCCGAGGTCCTTCTGGAAATGTGCATTAGGGGTCACC
TTGGAGGGTTCGATCTTCTGGAAGTTCTTGATGACGGAGACGACGCGGTCGGCGACCTCGCCCTTGTCGAGGAAAGAGCCCTTCTCCACCTCCGAGGTGG
AAGACAGGAGCCTGGCGACGGGGACGCTTCCCGCTGCTCCCGCTGCGACCGCGGGGCGCGCCACCGGCACGCGGAAGTGGTTAAGGAGGGCTCTCCTCGC
CGCCGCCATCGCCATTACCCGTGCAGTCGTGCAGCGAGTGGGGAGGAGAAGGCCCGG
page-top