Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13184  (registered. 2012)
Contig Information
Length 1250 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218191871|gb|EEC74298.1|| hypothetical protein OsI_09551 [Oryza sativa Indica Group]
Score 771
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13184
ACTGTTGACCGGGTGCAAGAGCTTCTTGAGAAAATCCGTGCTGCTTCCTGGGATCATGCTGTCCAAGATATGGAAGACCTAAAAGCCTTTGTGAAAGATT
CTGGTTCTGCAGAAGCCAATGATCTAGCACACTGGGATCTTAACTTCTGGAGTGAACGACTGCGGGAATCTAAATATGACATCGATGAGGAAGGGCTGCG
CCCTTACTTTGCACTGCCCAAGGTTATGGATGGCCTCTTCAGTCTTGCGAATAAGCTCTTTGGAATAACCGTTGAAGCTGCAGATGGATTGGCTCCTGTT
TGGAACAGTGACGTCAAATTTTATTGTGTCAAAGATTCTTCCAATAGCCCCGTTGCTTATTTTTACTTCGACCCATATTCAAGACCATCTGAAAAGCGTG
GTGGGGCTTGGATGAATGTCGTCTTTTCTCGTAGTAGTGTGCTAGCTCGCCATGGGTCTTCTGTAAGGCTGCCTGTTGCCCATATGGTGTGTAATCAGAT
GCCACCAGTTGGCGATAAGCCCAGTCTTATGACCTTCCGTGAGGTTGAAACCGTGTTCCATGAATTTGGTCACGCGCTGCAGCATATGCTTACCAGACAA
GATGAAGCCTTTGTTGCTGGTATCAGTGGAATAGAATGGGATGCCGTAGAGTTACCCTCTCAGTTCATGGAAAACTGGTGCTATCACAAGAATACACTTT
TGAGCATTGCAAAGCATTATGAAACCGGTGAACCTCTTCCAGAGGAAATCTATGCTAAGCTTGTGGCTGCAAAGAATTTCCGTGCTGGCACCTTCAGTCT
CCGTCAGATACGTTTCGCGAGTGTAGATATGGAACTGCATACAACTTATGATCCAAGTGGACCAGTGTCCGTGTATGATGTTGACCGAAGGGTTGCAGAG
AAAACCCAGGTTCTCGCTCCTCTGCCGGAGGACAGATTCCTGTGTGGATTCAGCCACATTTTTGCAGGTGGCTATGCAGCTGGATACTACAGTTACAAGT
GGGCTGAAGTGCTATCAGCCGATGCATTCTCAGCATTTGAAGATGTTGGTCTGGATAACGAGAAGGCCATTGAGGAGACGGGCAGACGATTCAGAGAAAC
GGTTCTTGCACTTGGAGGCGGGAAATCTCCGCTCGAGGTTTTCGTTGCTTTCCGAGGACGGGAGCCTTCGCCGGAGCCACTGCTGAGGCACAACGGCCTG
CTACCTGTTGCTGCATAGCGTGTCGATCGCTCTTTTTCTTAAAAAAAAAA
page-top