Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13159  (registered. 2012)
Contig Information
Length 865 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222623717|gb|EEE57849.1|| hypothetical protein OsJ_08475 [Oryza sativa Japonica Group]
Score 286
Evalue 2.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13159
TTTTTTTTTTAGTCCAATACCTTTATATCTTTGGTATATCAAGTTACAGAGTATTCAGCTAAATTTTGAGCAGGTTCTCATCACTCATCAGCTCTTAATC
TCCTATCAGCAACTTGGTGTACAACCGGCTTGTTTGAGCACTGATTGCAGAGGGGGAAAGGCAGCAATGGAACTCTGTTTAACTATTGTGCTTCGCTCAA
AACCCTGAACTAATTATTTCCCCTAAAAATGGGCGCGAAAAATAAACAACCGTAACCGGGCTACAGACAAGGTGATCAGTGCTCTCGCCACGCGAACTCA
TGTTACAGCGCCAGACCATTCTTCATCAGTGAAGCAAAACGCTGAAGAACCTCTGCTCGGCGCAGGTCCAGGCTGAACCCTGCCGGCGTGGGAATGGAAA
GGCCTCACAGGCACTTCTTGATGTCTGAAAATAACGACTTCTCTTTGTTTGCTGCCTCGACGTCGTCAGGCGATGCTACAGCCACCACAACCCCATTGTC
ATTGATCGTTTCGACAGCATCGGCAAACTCCTTGAAATCCTTCACGCTGGTTGCGAGTATCTCTTCGCGCCTTTGCTGGCGTTCCTCCTCGGTGATGCCC
AACAAATACCGCATCAGACTGCTGTAACCTTTAGCATCTGGTAGCTGGTAGGAATCAACATCCCCGATGGTTCCAATAATAGCTTTTGTGAGAGCATCAT
CATCTACATCTAGTTCTCTGAGGAACTTTGCAGTCCCATCATAGACCTCTAGTGTTTTCAGCAAGTTCGGATCACGGTATGACAAATACGAAAAGACCCC
TGAATGAGTGTCAAAATCACAAAACCCTCCATATGCGCCACCACTAACTCGAACGCGGTCCCATA
page-top