Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13145  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 2
WH_SP 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 21
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 18
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4090293|emb|CAA10497.1|| hypothetical protein [Secale cereale]
Score 362
Evalue 3.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13145
AGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCGCCGG
CCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCCATTGAGGGCATCAAG
AAGTTCGAGACCCTGTCCTACTTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCTTGCCTCGAGT
TCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCCCTGGGTACTATGATGGCCGGTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCAC
CGACGCCACACAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAG
TGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGT
TTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACCAACATGGC
TCGAGAAAGCATGCTCGTATGAGAATGCTATCGGTGGCTATGTATATGAACGGACGCATAATATTATACAATATGTCGACTATATACGTTTTAATGGTAA
CCAAT
page-top