Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13133  (registered. 2012)
Contig Information
Length 1025 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_EM Dormant seed with water absorption 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456641|ref|NP_001051921.1|| Os03g0852200 [Oryza sativa (japonica cultivar-group)]
Score 485
Evalue 3.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13133
CCCCGTCGTCGCTCTTCGATCCCGCCGGCGATTCCGTAGACGAGCGGCGAGAGGCGAGTAGCAGAGCGAGCGGGGAAGCTAGGGTTTCGGCGTGTGTGTG
CGGGAGGGGAGAAGAGGAGCGGGGATGGCGCAGGCGGTGGAGGAGTGGTACCGGCAGATGCCCATCATCACGCGCTCCTACCTCACCGCCGCCGTCCTCA
CCACCGTCGGCTGCACCCTCGAGATCATCTCGCCCTACCACCTCTACCTCAACCCCAAGCTGGTGGTGCAGCACTACGAGATCTGGCGCCTCGTCACCAA
CTTCCTCTACTTCCGCAAGATGGATTTGGATTTTCTGTTCCACATGTTTTTTCTTGCGCGCTACTGCAAACTTCTCGAGGAGAACTCATTCAGGGGAAGA
ACGGCTGACTTTTTCTACATGCTCTTGTTTGGTGCTACTGTCCTGACTAGCATCGTTCTGATTGGTGGGACAATACCTTACATCTCTGAGACGTTTGCTA
GGATTCTGTTCCTCAGCAATTCATTGACGTTTATGATGGTTTATGTCTGGAGCAAGCACAATCCCTTCATTCACATGAGCTTCTTGGGTCTGTTCACCTT
CACTGCTGCCTACTTACCTTGGGTCCTTCTTGGCTTCTCTATTCTGGTGGGGAGCAGCACATGGGTTGATCTTTTGGGTATGATTGCTGGTCATGTGTAC
TACTTCCTGGAAGATGTGTACCCTCGGATGACCGGCCGTCGCCCCCTGAAGACCCCTTCCTTCATCAAGGCGCTGTTCGCCGATGACAATGTGGTCGTGG
CGGCGCGGCCACCCAACGCTGGTGTTGGCGCGGCCGCAAGGTTCGGTGGCGTGGGTGCAGCAGACCCCCAGTTCCAGTGATGATGGACATGCAGTTTGTT
GGATATAATTTTGTACACCCGTGTCCGTGATGATATGTGCAAAAATACATACAGAGTATAATTCTCAGTTAGGGGTTGGTTTTGATGCCAATGCGCTGCT
AACCGAATTGTATGTAGCTGTGCTC
page-top