Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13085  (registered. 2012)
Contig Information
Length 821 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 15
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3758827|emb|CAA09867.1|| amino acid selective channel protein [Hordeum vulgare subsp.
Score 282
Evalue 4.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13085
GCACGAGGTCTTCTTGCTCTGCACTGCGCCACTACCTGGTCAGTCAAGAGAAGGAAAGATGCCTAGCGCGGGGCTGGAGGCGGGGTCGAACAAGGTGGAC
GTGGCCATCGACCTCGGGAACCCGCTCCTCAACCGCACCGTCGACGGCTTCCTCAAGATCGGCGCCGTCGGCGCCTGCAGGGTGGTCGCCGAGGACGCCT
TCGACTGCATCCACAGGGGGGATATCTCGAAGCGCCAGCTTGAAGAGACGCTGAAGAAAATGTGCAAGGAGGGTGCATATTGGGGTGCTGTTGCTGGGGT
GTATGTGGGCATGGAGTATGGAGTGGAAAGGGCCCGTGGTGACCGTGACTGGAAAAATGCGTTGATCGGAGGCATTGCAACCGGTGCCCTGGTCTCTGCT
GTGAGCAACAACAAAGGGAACAAGATCGCCCAGGACGCCATCACCGGAGGTGCCATCGCGACCGCCGTCGAGTTCATCAACTACCTCACCTAGCCGTGAG
GCCATCCATATTGGCAGCGACGTTTTTATCGGACAAGACTCAATAAGAACTTCTTGACTGAAGCCAAGCCATCCACCCTCTGTGTTAATAATTGGAGCCG
TTTCCTCCAATGTTCTTCCATTTTTTGTTGCCTGCCTCCTCATGTCCATGTTCTGAACAATTTATTTTTCTTCGTGGTTTGCATCCTTCAGTTATGACAC
CCTTTGTGCTGTGCCTGGTTTCGTACTAGCGTAGTTTTTTCATAGCCGTAGTAAAGGATCACACAGATGCCATCAGTAACCGCACCGTATAAGTTATGAC
ACCCTTTGTGCTGTATCCTCA
page-top