Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13075  (registered. 2012)
Contig Information
Length 837 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125552405|gb|EAY98114.1|| hypothetical protein OsI_20030 [Oryza sativa Indica Group]
Score 337
Evalue 7.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13075
CTTAGTTGCCACTGTAAAAACCTGAAGAGCTTAAATCTTTGTGGATGTGGAAAGGCAGCCACTGATGAATCCTTGCAGGCCATAGCCCAAAACTGTGGGC
ACCTGCAATCTTTGAACCTAGGTTGGTGTGACAGTGTCACAGATGAGGGGGTTACCAGCTTGGCATCAGGCTGCCCTGATCTCTGGGCCCTGGATTTGTG
TGGCTGTGTTCTTATAACAGACGAGAGTGTTATTGCTCTAGCAAGCGGGTGCCCCTACCTGCGATCTTTGGGCCTGTACTACTGCCAGAACATCACCGAC
CGAGCCATGTACTCCCTCGCAAACAGCTGCGTGAAGAGCAAACGAGGGAGGTGGGGCACCCCGCGGAGCAGCAGCAGCAGCTCGAAGGACGTCGACGGGC
TGGCGAACCTGAACATCAGCCAGTGCACGGCCCTGACGCCTCCGGCGGTCCAGGCGGTGTGCGACTCCTTCCCGTCGCTCCACACCTGCCCGGAGGGGCA
CTCCCTCATCATCAGCGGCTGCCTCAGCCTGACTAACGTCCACTGCGCCTGCGGCCTCCAGCGCCACCGCGCCGGAAGCGCCCTGCAGGCCACCAGCCAT
GCGTACTGAGGATGCGCGCGCTCTTGATTCCGGCGAACGCCGTGTGCCTCGTGGGGGGAGGTTTGGTCCCGGCCTGGAGAAGACGTGTATATAAACTCGG
AACCTGGAAATGTAATGTTGTAGTAGGACTATTGTATTATATCATGAGGACTCGATGCGGCCATGGAGTGCCAAATGGCTGGAGGGTTGCATGCTCTGCC
ATGCCATTCTTGAAACTGGCAAGAAATTGCATGCTAT
page-top