Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13042  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242079253|ref|XP_002444395.1|| hypothetical protein SORBIDRAFT_07g021250 [Sorghum bicolor]
Score 318
Evalue 6.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13042
TTTTTTTTTTATCAAGCGCAGAAAGAACATCAGGTTTTGGATTGAACTGACACGGCTCGAGTAATTTTCCATTTTGCTGTGCAGTTTACAGGCACCAACA
GCCAGACAGGTACATTTGCCACAGGGGTCTCACAAGTACCAAGAAAAACAGATCGGCATTACAGTGCAGTTCCAAAAATTGAAGACCAGAGGTGCTGCAC
AAAGCATAGGCAACTGCTCTATCGGATGAATAGCTCATTTTGGGAAGTACATCGGTTCGCCAGACAAGGCTGCATGAGGCAGAGCAGTAGGGGCTGTGCC
ATATTGTGCCATCTGCTGTGAAGCTTGGTACAACATCGGAGGAGCACCAGAGCTTGATCCGACTGCTGGAAAGTGCGGGCCTGGGTTTGCCATCAATAAT
TGGGTAGGGTACGAGGTTGATGCAGGTGCAAACGCCCCTCGCTGCATGTTAGGATTCCAGGCTGGCACTTGTCCGATAGAGGTCGCTCCTGCTGAGCTTC
CATAAAAAGCAGCAGGCGTGGTGCTTTGCCATGCTGCTCCAGTTGTGCTTAGACCAGGGGCTTGACCTGCAGCTTGTACCTGAGCACTAGGATCCGAGAC
GGTGTAATCTCTGCTTCTCTCGTCATGTGCCTTCACATTCAGATCAGTATGACGAGAGTATGACAGATGAAGCTTACAGTAACCACCATCATATATGCAA
TGTCCCTCCAGAGCTTGTTTAGCAACTCCTGCTGTTGTTATATCTGGATACTGAATTAGAGCCTGCATTCCACCATTCTTCTCGAACATTGCAATCTTTC
GGACAGCACCAAAAGAAGAGAACACAGTGTGTA
page-top