Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13019  (registered. 2012)
Contig Information
Length 587 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125532540|gb|EAY79105.1|| hypothetical protein OsI_34211 [Oryza sativa Indica Group]
Score 259
Evalue 1.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13019
CGGTACATGAAGCAGCAGCAGCAGCCACATCAAATGGGCATAAAAAATTCCAAGCAACACATCAATGACAATGGCAGTGAGAATGGCAATGGTGGTGGCT
CTCCTGCGAGGACGCGCAGGGGCTCTGAGGGTGTAGCGCCGGGAGGCCACAGGCTAGCCGGAGCTCGCTGTACCGGCGGACGTCAAAATCCCGGGCTTTC
ATCAGACGCTTCTGCTTCACCACAAAACGGCTCTGGAAGAAGCCCTCGAACGACGGCTCCCTCTTGGTCCGGAGGAAGAAGGCGTAGCCGGCCATGAAGT
ACGTCGACGTCACGAAGAAGCAGATGGGCTCCATGACGTCCCAGGAGAGCTCCCAGAATGTGAGCCTCATGAAGCCGGCCGTTTGGAGGGCCAGGGCAGC
CAGCCCTCCCCACAGCTCCCGCCGCACCTGGAGCGTCGCCATGCGGTCGATGTCTACCTTCTGGGCCTCCATGGCCTTCAGCTCCTCCCTTGCAGGGTGA
TTCTCAGCAACAGATAGCCCTCGCGGTATGGGTATTGCCTTCTCAATTGCTTTCACAACCTGAAATTTTGAAGAAAAGGACAAAAAC
page-top