Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13009  (registered. 2012)
Contig Information
Length 597 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig13009
TTTTTTTTTTGCAACTGAAAATGTGATTGTTATAAGCCAAATTCCAAATAAACGCACAAACATATCATTTGCCATTTACACATAGATCATGTTCATAATA
CAAACTCATTTCCTCGTATTGCAAACATCATCCCACTTCTACGACTTTCCTGCTACTGCAAACAGGATGACACACAAGCTAGCACACATACTGATTACAA
ACAGTAGCATCCTATCTCTGCATATAATTTGCTCCGTGTTGATCCTAGCAATGACCTTCTTCTCCATCTTGTGCTTCTCTTTATCAGCATGCTTCTCGGC
CTCCTTCTCAAGTCCAATCCCGGCATCTCCTCATCCTGAGCGCTTCTCTTTGATCCCCGGTTGTACACCGCCGTCTGCTTCCATTCCTCGTCGTCGCGCT
TCGGAACGTCGGCGCCACCCATCTCGCCTAGTAGCAGAGGAGAAGGGGGAGCAGAGAAAGAGTTCACATCGCTGCGCGAGTACTCCCGCCGCACCCTGGC
CTCCTACTCTCATTCAACTGCTCGTCGCCGGTTAGCGACCAAAGAATTCCACTGTCGCCGCCGCCGCCGCCGCCTACCTACGTTTAGGGATTCCCGG
page-top