Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12983  (registered. 2012)
Contig Information
Length 814 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_VWD Shoot grown with dessication 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238014948|gb|ACR38509.1|| unknown [Zea mays]
Score 218
Evalue 5.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12983
GCTTCTCCGTCCCGTACCCCTGCAGACCGCGATCTCCGCCTGAACCACCGGCCGGGACTGCTGCTCCGCTTGCTCTCCCCCGTCGGAGATCCGCCCGGAG
CGACTTTCGTCTTTCTGGGTTGTTCCGAAGCTGCAGAAGCCCAAACCCGGAAACAGAGTAGACGGCGCCGCATCTATATTTGCACTCCCACGCTTAAAGC
CGAGGCGGCGGAGGAAGCTGTGACAGCCATGGCGTCGTCGTTGGCAACGGCACCGGCTGCTGTACGCGATATGCAGTGCGACCTCGAGTCCCAGGCCAAC
GCCCTCAGCAAGATCCAGAAAGACATCTCCAAGAATCACGAGGTCCGCAAGCAGTTCACCATCCAGGTCGGCGAGAATGAACTCGTCCTCAAGGAGCTGG
AGCTGCTGAATGAAGGGGCGAACGTGTACAAGCTGATCGGGCCAGTGTTGGTCAAGCAGGACAATGCGGAGGCGAAGGCCAACATCAAAAAGCGCATCGA
GTACATCACAGCTGAGCTAATGAGAATGGATCGGGCGCTTAAGGACTTGGAGGAGAAACAGAATAGCAAGAAGGAATCGATAATCAAGCTGCAACAGAAG
ATGCAGGCTGTACAAGCAAAGGCGCAGGCGTAAATGAAGGGCTCCCTGCATTAGGGCCTTCGTCCTCCCAAATGTATGGGTCTGTACAAGGCGAAGTTAG
TTGCCTTGTGTTATCTATCCCCTAAAAAGGTGAAAGAAATCTGTAGTGTTCAGAGATTGAGAGAAGTTCCAGGTTTGTGTAGTGAGAGATTTTGTTTGAG
AGTGGATACTCGGT
page-top