Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12976  (registered. 2012)
Contig Information
Length 1283 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116283512|gb|AAH29790.1|| Unknown (protein for MGC:35458) [Homo sapiens]
Score 430
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12976
TCATGGCAGCGGAAAACATCGACGAGAAGAGGAACACCGACAAGTGGAAGGGTCTTGCGTACGATATCTCCGACGACCAGCAGGACATCACCAGAGGGAA
GGGCATCGTGGACTCCCTCTTCCAGGCGCCCACTGGCGACGGCACCCACGAGGCCGTCCTCAGCTCATACGAGTACGTCAGCCAGGGACTCAAGAAGTAC
GACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTGCCCAACATCA
AGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGAT
GAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGATCAAGAAGGGTAAGATG
TGCTGCCTCTTCATCAACGATCTTGACGCCGGTGCGGGTAGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTGAACGCCACCCTCATGA
ACATCGCCGATGCCCCCACCAATGTGCAGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCC
GTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCT
CTACCGGTATCGAGAACATTGGCAAGAAGCTGGTGAACTCGCGGGACGGACCAGTGACCTTTGAGCAGCCAAAGATGACAGTGGAGAAGCTGCTAGAGTA
CGGGCACATGCTCGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCG
ATGAAGACTGGTACCTTCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGCATAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCC
TGTACCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACGACGGCAGCTGCCTTTACACCTTTTAAGCATGCCAATTT
AATATCTGATGTTTTATCCTTTGTACCTAAGTACCGCATCGCATCCAAGCGATTGCTGGGCATGTTTTGTTAATATATAAAGA
page-top