Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12943  (registered. 2012)
Contig Information
Length 2130 bp
Clones alternative view 80 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
WH_XA Root 3
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440691|ref|NP_001044625.1|| Os01g0817700 [Oryza sativa (japonica cultivar-group)]
Score 1028
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12943
GCCGTCCGATGGCCCGATGAGCCGATCGGGCCGTCCGACGATCTTCTTGGCCAACACCCTAAATTATTCGCACCCCACGGCTCCGTGGCCCGTCCCTGCC
CCCCTTATTAATACCGCGGCCGCCCCGCCTTCGCCTATTATCCTCCGCCACTCCGCTCTCCCAAAAGTTCTTGTTTCGCAAACCACACGAAGAAAAAAGC
AAAGGAGATGGCGACCACGAATTGGACGCTCCCCGACCACCCCACGCTCCCCAAGGGGAAGACGGTGGCCGTCGTCGTGCTCGACGGATGGGGCGAGGCC
AGCCCCGACCAGTACAACTGCATCCATGTCGCCCAGACGCCCGTCATGGATTCGCTCAAGAATGGTGCTCCTGAGAAGTGGAGACTAGTGAAGGCTCATG
GAACTGCTGTTGGTCTCCCAAGTGACGACGACATGGGCAACAGTGAAGTTGGCCACAATGCTCTTGGAGCTGGCCGAATCTTTGCTCAAGGTGCGAAGCT
TGTTGATGCTGCTCTTGCTTCCGGGAAGATTTGGGAAGACGAGGGGTTCAATTACATCAAGGAATCTTTTGATAAGGGTACTCTGCACCTTATTGGTTTG
TTGAGTGATGGAGGCGTTCACTCCCGGCTAGACCAAGTGCAGTTGATTGTGAAAGGTGCCAGTGAGAGGGGAGCAAAAAGAATTCGCCTTCACATTCTTA
CTGATGGGCGTGATGTTTTGGATGGCAGTAGTGTTGGTTTTGTAGAGACAATTGAGAAAGATCTTGCTCAGCTTCGTGAGCAGGGTGTTGATGCACGGAT
TGCATCTGGTGGTGGAAGGATGTATGTTACCATGGACCGCTACGAGAATGACTGGAGTGTGGTCAAGCGTGGGTGGGATGCCCAGGTACTTGGAGAAGCA
CCACACAAATTCCAAAATGCACTTGAAGCTGTGAAGACTCTAAGAGCAGAGCCCAAGGCCAATGATCAGTATTTGCCTCCCTTTGTGATTGTTGATGAGA
GTGGCAAATCGGTTGGTCCTATAGTAGACGGTGATGCTGTCGTGACTTTCAATTTCAGAGCTGATCGCATGGTTATGCTTGCGAAAGCACTTGAGTTTCC
TGATTTTGATAAATTTGACCGTGTTCGTGTACCAAAAATTAAGTACGCTGGGATGCTTCAATATGATGGTGAGTTGAAGCTTCCAAGCAAGTACCTTGTT
TCCCCACCTTTGATTGAGAGGACATCTGGTGAATACTTGGTGAAGAATGGTGTCCGCACCTTCGCTTGCAGTGAAACAGTTAAGTTTGGCCATGTCACAT
TTTTCTGGAATGGAAACCGTTCGGGATACTTTGACGAGACCAGGGAAGAGTATGTAGAAATTCCCAGTGACAGTGGTATCACATTCAATGAGCAGCCCAA
AATGAAGGCACTTGAAATTGCTGAGAGAACTCGGGATGCTATCCTCAGTGGGAAGTTTGACCAGGTGCGTATTAACCTGCCAAACGGTGACATGGTTGGT
CACACTGGTGATATTGAAGCCACAGTTGTTGCTTGCAAGGCTGCTGATGAAGCTGTCAAGATGGTCTTGGATGCTGTGGAGCAAGTTGGTGGTATCTATC
TTGTCACAGCTGATCATGGAAACGCAGAGGATATGGTTAAGAGGAACAAAGCTGGCCAGCCGATGCTCGACAAGAGCGGCAGCATCCAGATTCTTACATC
GCACACGCTTCAGCCAGTCCCTGTTGCTATCGGAGGCCCTGGTCTCCACCCAGGAGTGAGATTCCGCTCCGACATCCAGACACCCGGGCTCGCCAACGTC
GCCGCCACCGTGATGAACCTCCATGGCTTCCAGGCTCCTGCTGATTACGAGACGACCCTCATCGAAGTCATTGACAAGTAAAAAAAAAACACTGCGCCCT
CTGAAGCCAAAATTGCTGCAGCCGATTTTGTCGCTATAGTTTTGGGGTGGGTCAAGGAATGATCGCATCATTGAATAATTTGAGATTTGCCAGCACGCTT
GCTCGAACTCATATGTAACATTGAGAAAGGTGGATTTTACTTGCAGTTAGCTCTATTTTGTAATTTGGGGTATTGCCATGCTGGTTTGCTTAACATACCG
ATAGCGATTTTTGCTCAGCTAAAAAAAAAA
page-top