Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12938  (registered. 2012)
Contig Information
Length 985 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291061972|gb|ADD73513.1|| ARF GTPase activator [Triticum aestivum]
Score 552
Evalue 3.00E-155
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12938
GCACAGATCCCTCCCTCTCCTCTGCACATCTCTCCTCCCTCCCCCACGACGCGGCAAAAACAGGGAGGAGAGAGAGCGAGAGAGGGAGCCCGAGCCCGAA
TCCCTGCGATCCCCCCTCCCGGTCTGAGGATCCGGCGATCAGCCATGAACGAGAAGGCCTCCGTCTCCAAGGAGCTCAACGCCAGGCACAAGAAGATATT
GGAAGGCCTTCTGCGGTTGCCGGAGAACAGAGAATGTGCAGACTGCAAGTCAAAGGGTCCTCGATGGGCAAGTGTCAATATTGGGATCTTCGTATGCATG
CAGTGTTCTGGAATTCATAGAAGCCTTGGGGTACACATATCAAAGGTAAGGTCTGCTACTCTGGATACATGGTTGCCAGAGCAAGTTGCATTTATTCAAT
CAATGGGAAATGAAAAGGCAAATGGCTATTGGGAAGCAGAGCTGCCCCCTAATTATGACAGGGTTGGGATAGAAAACTTCATCCGTGCAAAATACGAGGA
CAAGAGGTGGATACCGAGGAATGGAACATCAAAACTGCCCTCTGGTGCTCGAGATGAGAAGAGCTCTGAATCTCAGGCCAGTCATGCTAACAGGGGTGGG
CACGCTCAAAAACCTTCATTTGAGCAACACCGTGTTTCACCAGCTGCTACGAAAAGAACTGTTCCAGTGGCTTCTAGGATGCACACACAAGCATCACCTC
AGCCAAAAGCAGAACTACCAGTTCCCAAGGTTGCTTCGCCTCCTCAGCCAGCAAAATCTCCTGCTAAAGTTGATGTGACACCCCCAAAAGTTCATCAGCC
ATCGGTTGCACCCCCTCCTAAAGTTGACTATGCCATTGACCTCTTTAACATGTTATCAATGGACGGAACAACTGAGAAAGAATCAGAGTCATCTTCCAAC
GACGATAGTGCTTGGGATGGCTTCCAGTCTGCAGAACCAGCACCTAACTCCGAGAAAAAGGGTACTGCTAAGCCAGTAGAAAGTA
page-top