Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12935  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 91 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 7
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_OKCS Seed DPA5 5
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 4
WH_XA Root 13
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195641182|gb|ACG40059.1|| 60S ribosomal protein L21 [Zea mays]
Score 326
Evalue 2.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12935
TTTTTTTTTTACAAAATGCACTGAGAAGTAATTGAATCGATTGGGTCAAAGTTCAAAAGACAAACAGCAAGCTGCAGCAGCTCTGCAGTACCAAGGCTGT
AGAGGCAAAGAGAACCTTCGGAGGTAAGCAATGTAACTACATAGTTCAAAAGAGCACATCATCATTCTTAAGGAAATAGCACAGTATAGCATTTCTGCAA
AACTCATGATAGCAACCTACACCGAAAATCTTCTTGACATGAATAAAGACCCAACCCAGACTACTGCTCAGAGAGCAAATCCAACCCATAAGAGCACCAT
AGATTTGAACTGGTTGTGCAGGCAGATAACCCAAACACCCTAGTAACCACCCTTGAGATCATTGACCACATCGTACGGAATGGGAGTGACGGTCTCGATT
GTGGTACCCTCAACCATGAACCCAGGTTTAGGGCCGAGCGGCTGCCTCTTGGTGCTGATGACCTCACCACGTGCCTTGGCTTCCTCCTTGAGCTGGTCAT
TCTTCACTTTCCTCAGGCGGAACTCCTCCGCACACCTGGATGGCTGCACATGCTCAACACGGACATGGATCCTTTTCCTGATAATGCGGTTTCCAACCTG
CTTGTTGATCTCGACGCCGATGGCGCGCTTGGTGACGTTCCACACGCGTCCGGTGCGGCCGTGGTAGAACTTGTGCGGCATACCCTTGTGCACGGCGCCG
TTCACCTTGACATCGACGTACTCGCCGACCTTGTAGGTGCGCAGGTAGGTGGTGAGCGGGATGTAACCCTTCTTCCGGAACGGGCGCGCGAACAGGTCGC
GCGTCCGCGACCGCAGACCGTGGCCCGCCGGCATCCTGCTCCTCCTGCTTTGCTTCGCGGGGCGGCGGCGGGAGAA
page-top